Also, the pipeline is failing in a new place for me (still in call_alignment):
02:00:35 - INFO: Tagging the merged BAM with TRA/TRB exon info.
Traceback (most recent call last):
File "/usr/local/lib/python3.8/runpy.py", line 194, in _run_module_as_main
return _run_code(code, main_globals, None,
File "/usr/local/lib/python3.8/runpy.py", line 87, in _run_code
exec(code, run_globals)
File "/scripts/alignment.py", line 222, in <module>
main(args)
File "/scripts/alignment.py", line 123, in main
ds.fauxtag_exons(bam_merged, bam_exontagged)
File "/scripts/tcrgo/dropseq_tools.py", line 405, in fauxtag_exons
raise Exception(f"Unknown gene in {query.reference_name}!")
Exception: Unknown gene in M22198|TRDV1*01|!
2021/06/07 02:04:10 Starting delocalization.
2021/06/07 02:04:11 Delocalization script execution started...
2021/06/07 02:04:11 Delocalizing output /cromwell_root/memory_retry_rc -> gs://fc-d8b64044-a999-46bf-846b-b52b2a9a1b7c/6b9a7753-0a6d-4491-b3e5-e31da55d6f76/TCRGO/d2a2f36a-0807-4988-bb42-c2311413205b/call-alignment/memory_retry_rc
2021/06/07 02:04:11 Delocalizing output /cromwell_root/rc -> gs://fc-d8b64044-a999-46bf-846b-b52b2a9a1b7c/6b9a7753-0a6d-4491-b3e5-e31da55d6f76/TCRGO/d2a2f36a-0807-4988-bb42-c2311413205b/call-alignment/rc
2021/06/07 02:04:12 Delocalizing output /cromwell_root/stdout -> gs://fc-d8b64044-a999-46bf-846b-b52b2a9a1b7c/6b9a7753-0a6d-4491-b3e5-e31da55d6f76/TCRGO/d2a2f36a-0807-4988-bb42-c2311413205b/call-alignment/stdout
2021/06/07 02:04:13 Delocalizing output /cromwell_root/stderr -> gs://fc-d8b64044-a999-46bf-846b-b52b2a9a1b7c/6b9a7753-0a6d-4491-b3e5-e31da55d6f76/TCRGO/d2a2f36a-0807-4988-bb42-c2311413205b/call-alignment/stderr
2021/06/07 02:04:15 Delocalizing output /cromwell_root/out/pregnancy_test2_repairedsorted.bam -> gs://fc-d8b64044-a999-46bf-846b-b52b2a9a1b7c/6b9a7753-0a6d-4491-b3e5-e31da55d6f76/TCRGO/d2a2f36a-0807-4988-bb42-c2311413205b/call-alignment/out/pregnancy_test2_repairedsorted.bam
Required file output '/cromwell_root/out/pregnancy_test2_repairedsorted.bam' does not exist.
I don't see anything suspicious with the syntax of this gene name in the reference I'm using (from here).
>M22198|TRDV1*01|
gcccagaaggttactcaagcccagtcatcagtatccatgccagtgaggaaagcagtcacc
ctgaactgcctgtatgaaacaagttggtggtcatattatattttt
tggtacaagcaacttcccagcaaagagatgattttccttattcgccagggt
tctgatgaacagaatgcaaaaagtggtcgctattctgtcaacttc
aagaaagcagcgaaatccgtcgccttaaccatttcagccttacagctagaagattcagca
aagtacttttgtgctcttggggaact
Though I suppose I can just dump the TRD* and TRG* genes from the reference since they shouldn't be sequenced anyways, it'd be nice to know what's causing this. Also, let me know if you recommend using a different human reference than the one in the original repo.
any thoughts? thanks again so much for your help! I'll let you know if I run into the BC/UMI collapse issue, the core ran bcl2fastq on these so I'm actually not sure what to expect at that stage!
Originally posted by @ajwilk in #1 (comment)
Also, the pipeline is failing in a new place for me (still in
call_alignment):I don't see anything suspicious with the syntax of this gene name in the reference I'm using (from here).
Though I suppose I can just dump the TRD* and TRG* genes from the reference since they shouldn't be sequenced anyways, it'd be nice to know what's causing this. Also, let me know if you recommend using a different human reference than the one in the original repo.
any thoughts? thanks again so much for your help! I'll let you know if I run into the BC/UMI collapse issue, the core ran bcl2fastq on these so I'm actually not sure what to expect at that stage!
Originally posted by @ajwilk in #1 (comment)