Skip to content

BUGS.md

Latest commit

 

History

History
64 lines (49 loc) · 2.83 KB

BUGS.md

File metadata and controls

64 lines (49 loc) · 2.83 KB

[X] 20241120-01 : Do not check if true fastq

- say nothing if not a not a true fastq

[X] 20241113-01 : In few fastq files, all kmers are count to 0

- happens on crozet data microglie
- when a read smaller than k

[ ] 20230911-01 : segfault with summary, but not all the time

- run: echo GACACAAAAGAGGAAAAGTGAACCCAAAACATACA |  countTags -i - -k 31 --nostranded --summary titi ../test/input_bcalm/SRR10092187_10k.fastq
- output:
    tag	SRR10092187_10k.fastq
    GACACAAAAGAGGAAAAGTGAACCCAAAACA	2
    Erreur de segmentation
- data from reindeer
- not present if no summary asked

[ ] 20210425-01 : Count twice the read if read are paired and overlapping

  • Solution 1:
    • analyse paired reads in same time and check if same kmer
      • problem may be if kmer is repeated ?

[X] 20200419-01 : Do not output the number of read in fastq sample

  • Use the wrongth variable (line_id=nline_read) = number of line and not read
  • Use nread to output the rigth value (commit 459de402587)

[X] 20200326-01 : Do not normalize count

  • the code was commented !!! (commit 1adf838c)

[ ] 20190930-01 : mergeTagCounts do not manage tag name in file

[X] 20180625-01 : Do not manage paired fastq files in stranded mode

  • Paired fastq file are not considered, always using forward strand for the two pair (commit 44f5dae1)

[X] 20180508-01 : Do not stop if no tag given

  • Add a test to exit if no tag given in tag file or stdin (commit 5dd253e)

[X] 20180508-02 : Try to open stdin if tag filename is oneletter

  • Test filename is '-' if stdin, and not filename size =1 (commit c23716a3)

[X] 20180329-02 : No information is output when tag are drop because they are shorter than kmer

  • Output on sdterr, tag shorter than kmer (commit 67546ef9d1ccf).

[X] 20180329-01 : When asking for -h -V, got error for nothing with -i

  • due to Bug #20180326-01 (commit 451314ffc4a).

[X] 20180328-01 : Do not Test if fastq.gz files are present

  • done in commit 63b14cd3eb.

[ ] 20180328-02 : Output the original sequence and not the shorter alphabetic tag

  • Solution 1:
    • use 1 bit to store if the tag is forward or reverse-complement
    • but only 31 bits for the tag.
  • Solution 2:
    • store in hash: DNAid -> sequence
    • store in hash, or array if get tag line number: 0 for F, 1 for R, and reverse or not the DNAid if required

[-] 20180326-02 : When kmer length > 32, sequences are scramble

  • at this time add a message and exit if kmer > 32 (commit bf8e7f80105)
  • Problem probably with storrage UINT32, as pointed by JA in Readme

[X] 20180326-01 : Do not test if there is a tags file, always take first argument as tag file

  • Solution: put the tag filename as argument with option '-i'
  • Not Working as expected: the Arg::Required is not working
  • So for now, test with a 'if' condition, in main code (commit 451314ffc4a).