diff --git a/tools/rna_tools/vienna_rna/kinfold.xml b/tools/rna_tools/vienna_rna/kinfold.xml index a98ec96fc0..2ed56875df 100644 --- a/tools/rna_tools/vienna_rna/kinfold.xml +++ b/tools/rna_tools/vienna_rna/kinfold.xml @@ -1,18 +1,18 @@ - - Simulates the stochastic folding kinetics of RNA sequences into secondary structures. + + Simulate stochastic folding kinetics of RNA sequences Kinfold macros.xml - - - - - + + + + '$output' && cat *.log > '$log' ]]> - - - - + + + -
- +
- -
- - - - - - +
+ + + + + +
-
- - + +
- - - + + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/kinwalker.xml b/tools/rna_tools/vienna_rna/kinwalker.xml index c06007a22c..fb08407a6e 100644 --- a/tools/rna_tools/vienna_rna/kinwalker.xml +++ b/tools/rna_tools/vienna_rna/kinwalker.xml @@ -1,14 +1,15 @@ - - cotranscriptional folding of RNAs + + Simulate cotranscriptional folding of RNAs kinwalker + 2.6.4 macros.xml - - - - - + + + + seq.ident && sed '1d' '$input_sequence' > input.seq @@ -16,117 +17,111 @@ kinwalker $init_structure $interrupt - ##$printfront - --barrier_heuristic $barrier_heuristic.used - #if $barrier_heuristic.used == "M" --grouping $barrier_heuristic.grouping --lookahead $barrier_heuristic.lookahead #else if $barrier_heuristic.used == "B" --maxkeep $barrier_heuristic.maxkeep #end if - --dangle $dangle --noLonelyPairs $noLonelyPairs --transcribed $transcribed --transcription_rate $transcription_rate --windowsize $windowsize - < input.seq - > blah - - && - sed -n '2s/[\.\(\)]\+\s\+\(.\+\)$/ mfe: \1/p' blah > energy - - && - cat seq.ident energy > '$mfe_struct' - - && - sed -e '2s/^\([\.\(\)]\+\).*$/\1/' -ne '1,2p' blah >> '$mfe_struct' - - && - sed -e 's/[ \t]*$//' -ne '/TRAJ/,/Kinwal/ {/TRAJ/n;/Kinwal/!{s/\s/\t/gp}}' blah > '$trajectory' + && + sed -n '2s/[\.\(\)]\+\s\+\(.\+\)$/ mfe: \1/p' blah > energy + && + cat seq.ident energy > '$mfe_struct' + && + sed -e '2s/^\([\.\(\)]\+\).*$/\1/' -ne '1,2p' blah >> '$mfe_struct' + && + sed -e 's/[ \t]*$//' -ne '/TRAJ/,/Kinwal/ {/TRAJ/n;/Kinwal/!{s/\s/\t/gp}}' blah > '$trajectory' ]]> - - - + + - + - + - + - + - + - + - + - - - - - + + + + - - + + - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + - -100), heuristic approaches have to be employed which explicitly construct a (re)folding path between the two structures. The saddle height is then estimated as the highest point along the path. The best known algorithm for approximating saddle heights between RNA conformations is the Morgan-Higgs heuristic, which tries to find a folding path from an origin secondary structure to a target secondary structure where the maximum height along the path is minimal. The heuristic models state transitions at base pair resolution. -]]> +This is done in such a way that the new structure includes base pairs from both structures in an energetically favorable manner. Kinwalker estimates the waiting times for individual folding events depending on the height of the energy barrier between the current structure and the new structure. Folding events between structures can only occur if the energy barrier between them is less than the maximum allowed energy barrier. + +As folding paths can only be calculated exhaustively for short sequences, heuristic approaches have to be employed which explicitly construct a (re)folding path between the two structures. The best known algorithm for approximating saddle heights between RNA conformations is the Morgan-Higgs heuristic. -**Input** +----- -RNA sequence in FASTA format +**Input format** -**Output** +A single RNA sequence in FASTA format. -RNA folding trajectory +----- +**Outputs** + +- MFE structure in FASTA format +- Folding trajectory in tabular format +]]> 10.1016/j.jmb.2008.02.064 diff --git a/tools/rna_tools/vienna_rna/macros.xml b/tools/rna_tools/vienna_rna/macros.xml index 262db0d6f5..f1b8bf84ae 100644 --- a/tools/rna_tools/vienna_rna/macros.xml +++ b/tools/rna_tools/vienna_rna/macros.xml @@ -1,24 +1,29 @@ + 2.7.2 + 0 + 25.0 - viennarna + viennarna - 2.2.10 @EXECUTABLE@ --version - - - - - - - - + + + viennarna + + + + + + + + + - 10.1186/1748-7188-6-26 diff --git a/tools/rna_tools/vienna_rna/rna2dfold.xml b/tools/rna_tools/vienna_rna/rna2dfold.xml index c4d346ee2d..79d31c2207 100644 --- a/tools/rna_tools/vienna_rna/rna2dfold.xml +++ b/tools/rna_tools/vienna_rna/rna2dfold.xml @@ -1,14 +1,14 @@ - - explore structure space between two reference structures + + Explore structure space between two reference structures RNA2Dfold macros.xml - - - - - + + + + -1 and int($nl) > -1 --neighborhood=$nk:$nl @@ -21,7 +21,7 @@ $advancedOptions.noclosinggu $advancedOptions.notetra $advancedOptions.circ - #if $varExists('$advancedOptions.maxK') + #if $varExists('$advancedOptions.maxK') --maxDist1=$advancedOptions.maxK --maxDist2=$advancedOptions.maxL #end if @@ -29,17 +29,16 @@ ]]> - + - - - + + + - + @@ -48,61 +47,48 @@ - - +
- - - - - - - - + + + + + +
- + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnaaliduplex.xml b/tools/rna_tools/vienna_rna/rnaaliduplex.xml index b64d71eb93..04cdb9990e 100644 --- a/tools/rna_tools/vienna_rna/rnaaliduplex.xml +++ b/tools/rna_tools/vienna_rna/rnaaliduplex.xml @@ -1,14 +1,14 @@ - - find binding sites of two RNA alignments + + Find binding sites of two RNA alignments RNAaliduplex macros.xml - - - - - + + + + - - + + - - + + - + - +
- - - - - - + + + + + +
- + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnaalifold.xml b/tools/rna_tools/vienna_rna/rnaalifold.xml index 74c6330c8d..9fcdb8380f 100644 --- a/tools/rna_tools/vienna_rna/rnaalifold.xml +++ b/tools/rna_tools/vienna_rna/rnaalifold.xml @@ -1,17 +1,18 @@ - + Calculate minimum free energy secondary structures and partition function on a multiple alignment file RNAalifold macros.xml - - - - - '$tabularFile' - + + + + + "alignment" + #if str($IDs.id_prefix) != "alignment" --id-prefix='$IDs.id_prefix' #end if $IDs.continuous_ids $IDs.auto_id - #if $IDs.id_digits <> 4 + #if $IDs.id_digits != 4 --id-digits=$IDs.id_digits #end if - #if $IDs.id_start <> 1 + #if $IDs.id_start != 1 --id-start=$IDs.id_start #end if - #if $constraints.maxBPspan <> -1 + #if $constraints.maxBPspan != -1 --maxBPspan=$constraints.maxBPspan #end if #if str($constraints.constraintLocation.constraintSelector) == "fromFile" --constraint='$constraints.constraintLocation.constraintsFile' $constraints.constraintLocation.batch - $constraints.ss_cons - #end if + $constraints.SS_cons + #end if #if str($constraints.shapeOption.shapeSelector) == "isUsed" #if len($constraints.shapeOption.shape_files) > 0 #set $sf=list() @@ -57,227 +58,193 @@ $sf.append(str('$i.shape')) #end for --shape= #echo ','.join($sf) - #if $constraints.shapeOption.m <> 1.8 or $constraints.shapeOption.b <> -0.6 + #if $constraints.shapeOption.m != 1.8 or $constraints.shapeOption.b != -0.6 #set $s="Dm"+str($constraints.shapeOption.m)+"b"+str($constraints.shapeOption.b) --shapeMethod=$s - #end if + #end if #end if #end if - #if $algorithm_options.pf <> "-1" + #if $algorithm_options.pf != "-1" --partfunc=$algorithm_options.pf --pfScale=$algorithm_options.pfScale - #end if - #if $algorithm_options.measelect.mea == "yes": + #if $algorithm_options.measelect.mea == "yes" --MEA=$algorithm_options.measelect.meavalue --pfScale=$algorithm_options.pfScale #end if $algorithm_options.mis - #if $algorithm_options.stochBT_en <> 1 + #if $algorithm_options.stochBT_en != 1 --stochBT_en=$algorithm_options.stochBT_en #end if - $algorithm_options.circular - #if $algorithm_options.bppmThreshold <> 1e-6 + $algorithm_options.circ + #if $algorithm_options.bppmThreshold != 1e-6 --bppmThreshold=$algorithm_options.bppmThreshold #end if $algorithm_options.gquad - $algorithm_options.sci - $model_options.notetra - $model_options.nolp - $model_options.nogu - $model_options.noclosinggu - #if $model_options.cfactor <> 1.0 + $algorithm_options.sci + $model_options.noTetra + $model_options.noLP + $model_options.noGU + $model_options.noClosingGU + #if $model_options.cfactor != 1.0 --cfactor=$model_options.cfactor #end if - #if $model_options.nfactor <> 1.0 + #if $model_options.nfactor != 1.0 --nfactor=$model_options.nfactor #end if $model_options.endgaps - $model_options.ribosum + $model_options.ribosum_scoring #if $model_options.nsp --nsp='$model_options.nsp' #end if - #if $model_options.betaScale <> 1.0 + #if $model_options.betaScale != 1.0 --betaScale=$model_options.betaScale #end if - && tar -cf '$imagesFile' *.ps + + < ./input.${input.ext} > '$tabularFile' + + && tar -cf '$imagesFile' *.ps ]]> -
- + - + - - + - + + - - - - - - - - -
+ + + + + + + +
- - - - + + + + - +
-
- - - - - +
+ + + + +
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + + + + + + + + + + +
- + - + - - - - - - - - - - + + + + + + + + + +
- - + + - + - + - + - + - + - - - + + + - - +
+ + + +
+ - - - - - + diff --git a/tools/rna_tools/vienna_rna/rnacofold.xml b/tools/rna_tools/vienna_rna/rnacofold.xml index ee5de99f2c..0d8e3b8427 100644 --- a/tools/rna_tools/vienna_rna/rnacofold.xml +++ b/tools/rna_tools/vienna_rna/rnacofold.xml @@ -1,34 +1,34 @@ - + Calculate secondary structures of two RNAs with dimerization RNAcofold macros.xml - - - - - '$tabularFile' - -T$model_options.temperature -d$model_options.dangling + + + + + '$tabularFile' + -T$model_options.temperature -d$model_options.dangling $general_options.noPS - $general_options.noconversion + $general_options.noconversion $IDs.auto_id - #if str($IDs.id_prefix) <> "alignment" + #if str($IDs.id_prefix) != "alignment" --id-prefix='$IDs.id_prefix' #end if - #if $IDs.id_digits <> 4 + #if $IDs.id_digits != 4 --id-digits=$IDs.id_digits #end if - #if $IDs.id_start <> 1 + #if $IDs.id_start != 1 --id-start=$IDs.id_start - #end if + #end if #if str($constraints.constraintLocation.constraintSelector) == "fromFile" --constraint='$constraints.constraintLocation.constraintsFile' $constraints.constraintLocation.canonicalBPonly - $constraints.constraintLocation.enforceConstraint + $constraints.constraintLocation.enforceConstraint #end if - #if str($constraints.constraintLocation.constraintSelector) == "inFile" + #if str($constraints.constraintLocation.constraintSelector) == "inFile" -C #end if $algorithm_options.allpf @@ -37,16 +37,16 @@ --concfile='$i.concfile' #end for #end if - #if $algorithm_options.pf <> "-1" + #if $algorithm_options.pf != "-1" --partfunc=$algorithm_options.pf #end if - #if $algorithm_options.pfScale <> 1.07 + #if $algorithm_options.pfScale != 1.07 --pfScale=$algorithm_options.pfScale #end if - #if $algorithm_options.bppmThreshold <> 1e-5 + #if $algorithm_options.bppmThreshold != 1e-5 --bppmThreshold=$algorithm_options.bppmThreshold #end if - $algorithm_options.gquad + $algorithm_options.gquad $model_options.notetra $model_options.nolp $model_options.nogu @@ -54,134 +54,105 @@ #if $model_options.nsp --nsp='$model_options.nsp' #end if - #if $model_options.betaScale <> 1.0 + #if $model_options.betaScale != 1.0 --betaScale=$model_options.betaScale #end if - ]]> - +
- - + +
-
- - - - +
+ + + +
- - + + - - - + + + - - - - - - + + + + + +
- - - - - - - - - - - - - - - - + + + + + + + + + + + + + +
- + - - + + - - - + + + - - - - -
+ + + + +
- - - + + + - - pf is True + + algorithm_options['pf'] != "-1" - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnadistance.xml b/tools/rna_tools/vienna_rna/rnadistance.xml index 2710879107..d93f180033 100644 --- a/tools/rna_tools/vienna_rna/rnadistance.xml +++ b/tools/rna_tools/vienna_rna/rnadistance.xml @@ -1,85 +1,77 @@ - - Calculate distance between secondary structures of two RNAs + + Calculate distances between secondary structures of RNAs RNAdistance macros.xml - - - - - + + + + '$outfile' --distance=#echo ''.join(str($distance).split(','))# --compare=$compare $shapiro $backtrack - #if $backtrack and str($compare)=="m" + #if $backtrack and str($compare) == "m" && cat backtrack.file >> '$outfile' #end if ]]> - - - - - - - - - - - + + + + + + + + + + + - - + + - + - - + + - + - + - -' -2nd line: sequence -3rd line: first secondary structure in dot-bracket notation -4th line: second secondary structure in dot-bracket notation -... -nth line: another sequence -... +RNAdistance requires one input file. Each entry consists of: -Several different RNA secondary structures can be specified. The input has a Fasta-like structure but with secondary structure information. +- Optional comment line starting with '>' +- RNA sequence +- One or more secondary structures in dot-bracket notation - ------- +----- **Outputs** -* distance of the structures -* with the backtrack options it is possible to get alignment ouput - - +- Distance between the structures +- With `--backtrack`: alignment output appended ]]> - + diff --git a/tools/rna_tools/vienna_rna/rnaduplex.xml b/tools/rna_tools/vienna_rna/rnaduplex.xml index 71fb1bb1fa..0c4eff34db 100644 --- a/tools/rna_tools/vienna_rna/rnaduplex.xml +++ b/tools/rna_tools/vienna_rna/rnaduplex.xml @@ -1,14 +1,14 @@ - + Compute the structure upon hybridization of two RNA strands RNAduplex macros.xml - - - - - + + + + '$tabularFile' -T$temperature -d$dangling --deltaEnergy=$denergy #if $varExists('$advancedOptions.noconversion') @@ -24,62 +24,58 @@ ]]> - - - + + + - + - - + + - - - + + + - - - - - - - - + + + + + + + - + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnaeval.xml b/tools/rna_tools/vienna_rna/rnaeval.xml index 5a278916b4..44da10cc06 100644 --- a/tools/rna_tools/vienna_rna/rnaeval.xml +++ b/tools/rna_tools/vienna_rna/rnaeval.xml @@ -1,14 +1,14 @@ - + Calculate energy of RNA sequences with given secondary structure RNAeval macros.xml - - - - - + + + + '$tabularFile' -T$temperature -d$dangling #if $varExists('$advancedOptions.noconversion') @@ -25,7 +25,7 @@ --shapeMethod=$s #else if str($advancedOptions.shapeOption.shapeMethod.methodSelector) == "Z" #set $s="Zb"+str($advancedOptions.shapeOption.shapeMethod.b) - --shapeMethod=$s + --shapeMethod=$s #if str($advancedOptions.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C" #set $c="C"+str($advancedOptions.shapeOption.shapeMethod.shapeConversion.c) --shapeConversion=$c @@ -49,36 +49,36 @@ - - + + - + - - - + + + - - - - - - + + + + + + - - + + - + - + @@ -88,20 +88,18 @@ - + - - + + - - + - - + @@ -112,47 +110,41 @@ - - + - - + - - + - + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnafold.xml b/tools/rna_tools/vienna_rna/rnafold.xml index 161e11c767..bd73e7d784 100644 --- a/tools/rna_tools/vienna_rna/rnafold.xml +++ b/tools/rna_tools/vienna_rna/rnafold.xml @@ -1,15 +1,19 @@ - + Calculate minimum free energy secondary structures and partition function of RNAs RNAfold macros.xml + + - biopython + biopython - - - + + + + + " @@ -115,7 +119,6 @@ > '$dot_bracket_stdout' ]]> - @@ -136,14 +139,12 @@ - + - - - +
@@ -152,148 +153,102 @@ - - - - - - + + + + + +
- - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + - - - - - - - + + + + + + + + + + + + + - - - - - - - - - - - - - - - - - - - - + - - - - - - - + + + + - + + + - + + + - + + + + + - - - - + + + + - - + +
- - - - + + + +
advancedOptions['nops'] is False - + pf is True @@ -301,56 +256,67 @@ - - - + + + + + - - - - - + + + + + + - - - - + + + + + + - - + + - - - + + - - - - + + + + + + - - - + + + + + - - - - - + + + + - +
+ + + + +
- - + - + diff --git a/tools/rna_tools/vienna_rna/rnaheat.xml b/tools/rna_tools/vienna_rna/rnaheat.xml index 18f6ee85b8..fe1f885713 100644 --- a/tools/rna_tools/vienna_rna/rnaheat.xml +++ b/tools/rna_tools/vienna_rna/rnaheat.xml @@ -1,14 +1,14 @@ - + Calculate energies of RNA in a temperature range RNAheat macros.xml - - - - - + + + + '$output' --Tmin $tmin --Tmax $tmax -d$dangling --stepsize=$stepsize --ipoints=$ipoints #if $varExists('$advancedOptions.noconversion') @@ -23,68 +23,60 @@ #end if ]]> - - - - - - - + + + + + + - + - - - + + + - - - - - - - - + + + + + + + - + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnainverse.xml b/tools/rna_tools/vienna_rna/rnainverse.xml index ce544ef55d..8f35d44759 100644 --- a/tools/rna_tools/vienna_rna/rnainverse.xml +++ b/tools/rna_tools/vienna_rna/rnainverse.xml @@ -1,14 +1,14 @@ - - Calculate RNA sequence from secondary structure + + Calculate RNA sequence from secondary structure RNAinverse macros.xml - - - - - + + + + '$outfile' --function=#echo ''.join(str($algo).split(',')) -R$reps @@ -21,43 +21,39 @@ ]]> - + - - - - - - + + + + + - - - + + - - - - + + + - - - - - + + + + - + - + @@ -66,26 +62,23 @@ - -' in the beginning are treated as comments. Characters in the start sequence other than "AUGC" will be treated as wild cards and replaced by a random character. Any lower case characters in the start sequence will be kept fixed during the search. If necessary, the sequence will be elongated to the length of the structure. Thus a string of "N"s as well as a blank line specify a random start sequence. +Input is similar to FASTA format. First line: structure in dot-bracket notation; second line: starting sequence. Characters in the start sequence other than "AUGC" are treated as wildcards. Lower case characters are kept fixed during the search. ------- +----- **Outputs** -- text output of each sequence with its Hamming distance and/or the energy if the partition function is selected - +- Text output: each sequence with its Hamming distance and optionally the energy if partition function is selected ]]> - + diff --git a/tools/rna_tools/vienna_rna/rnalalifold.xml b/tools/rna_tools/vienna_rna/rnalalifold.xml index 6767361d21..7d33d2c70b 100644 --- a/tools/rna_tools/vienna_rna/rnalalifold.xml +++ b/tools/rna_tools/vienna_rna/rnalalifold.xml @@ -1,14 +1,14 @@ - + Calculate locally stable secondary structures for a set of aligned RNAs RNALalifold macros.xml - - - - - + + + + '$output' -T$temperature -d$dangling -L$span @@ -24,74 +24,60 @@ #end if ]]> - - - - - + + + + - + - - - + - - - + + + - - - - - - - - - - + + + + + + + + - - - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnalfold.xml b/tools/rna_tools/vienna_rna/rnalfold.xml index 7620857d3b..f63bfc32fc 100644 --- a/tools/rna_tools/vienna_rna/rnalfold.xml +++ b/tools/rna_tools/vienna_rna/rnalfold.xml @@ -1,16 +1,15 @@ - - calculates locally stable secondary structures of RNA - + + Calculate locally stable secondary structures of RNA RNALfold macros.xml - - - - - + + + + "" + #if $advancedOptions.activateZscore + #if str($advancedOptions.zscore) != "" --zscore=$advancedOptions.zscore #else --zscore @@ -30,69 +29,61 @@ ]]> - - + + - + - - - + + + - - - - - - - - - - + + + + + + + + + - + - - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnapaln.xml b/tools/rna_tools/vienna_rna/rnapaln.xml index 9b20b6085c..5035aff931 100644 --- a/tools/rna_tools/vienna_rna/rnapaln.xml +++ b/tools/rna_tools/vienna_rna/rnapaln.xml @@ -1,15 +1,14 @@ - - RNA alignment based on sequence base pairing propensities - + + RNA alignment based on sequence base pairing propensities RNApaln macros.xml - - - - - + + + + '$output' --mode=$alignmentmode -T$temperature -d$dangling @@ -25,88 +24,78 @@ $advancedOptions.noclosinggu $advancedOptions.notetra #end if - #if $backtrack and str($alignmentmode)=="m" - && cat backtrack.file >> '$outfile' + #if $backtrack and str($alignmentmode) == "m" + && cat backtrack.file >> '$output' #end if ]]> - - + - + - - + + - + - - - - - - - - - + + + + + - - - + + + - - - - - - - + + + + + + - - + + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnapdist.xml b/tools/rna_tools/vienna_rna/rnapdist.xml index 568e25b4d1..db2c0ebe48 100644 --- a/tools/rna_tools/vienna_rna/rnapdist.xml +++ b/tools/rna_tools/vienna_rna/rnapdist.xml @@ -1,16 +1,14 @@ - - Calculate distances between thermodynamic RNA secondary structure ensembles - - + + Calculate distances between thermodynamic RNA secondary structure ensembles RNApdist macros.xml - - - - - + + + + '$output' --compare=$compare -T$temperature -d$dangling @@ -22,80 +20,72 @@ $advancedOptions.noclosinggu $advancedOptions.notetra #end if - #if $backtrack and str($compare)=="m" - && cat backtrack.file >> '$outfile' + #if $backtrack and str($compare) == "m" + && cat backtrack.file >> '$output' #end if - ]]> - - + - + - - + + - + - + - - - + + + - - - - - - - + + + + + + - - - + + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnapkplex.xml b/tools/rna_tools/vienna_rna/rnapkplex.xml index 39254df23f..969c9d727c 100644 --- a/tools/rna_tools/vienna_rna/rnapkplex.xml +++ b/tools/rna_tools/vienna_rna/rnapkplex.xml @@ -1,15 +1,14 @@ - - predicts RNA secondary structures including pseudoknots - + + Predict RNA secondary structures including pseudoknots RNAPKplex macros.xml - - - - - + + + + '$output' -T$temperature --energyCutoff=$energycutoff @@ -25,71 +24,60 @@ #end if ]]> - - - - + + + - - - + + + - - - - - - - - - - + + + + + + + + + - - - + + + - + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnaplex.xml b/tools/rna_tools/vienna_rna/rnaplex.xml index 83ee409d9a..2cd7eb4901 100644 --- a/tools/rna_tools/vienna_rna/rnaplex.xml +++ b/tools/rna_tools/vienna_rna/rnaplex.xml @@ -1,21 +1,20 @@ - + Find targets of a query RNA - RNAplex macros.xml - - - - - + + + + '$output' ]]> - - - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + + + + + - - - - - - - - - - - - - + + + + + + + + + + - - - + + + - - - - + + + + - - - - + + + - + - - - + + + + + + - - - + diff --git a/tools/rna_tools/vienna_rna/rnaplfold.xml b/tools/rna_tools/vienna_rna/rnaplfold.xml index 4a47e63106..46aa333549 100644 --- a/tools/rna_tools/vienna_rna/rnaplfold.xml +++ b/tools/rna_tools/vienna_rna/rnaplfold.xml @@ -1,15 +1,14 @@ - - predicts RNA secondary structures including pseudoknots - + + Calculate average pair probabilities over sliding windows RNAplfold macros.xml - - - - - + + + + files.tmp - && tar -cf '$outputf' --files-from=files.tmp - + #if $onthefly or $openingenergies or $unpairedOption.unpairedSelector == "yes" + && find . -name '*_basepairs' -or -name '*_lunp' -or -name '*_openen*' > files.tmp + && tar -cf '$outputf' --files-from=files.tmp + #end if ]]> - - - - + + + - - - - - - + + + + + - - - + + + - - - + + - - - + + + - - - - - - - + + + + + + - + - + + onthefly or openingenergies or unpairedOption['unpairedSelector'] == 'yes' + - + - + - + + + + + + + + + + + + + + + + + + + + - - - + diff --git a/tools/rna_tools/vienna_rna/rnaplot.xml b/tools/rna_tools/vienna_rna/rnaplot.xml index 32824248be..c0afc75982 100644 --- a/tools/rna_tools/vienna_rna/rnaplot.xml +++ b/tools/rna_tools/vienna_rna/rnaplot.xml @@ -1,21 +1,25 @@ - - Draw RNA Secondary Structures + + Draw RNA secondary structures RNAplot macros.xml - - - - - + + + + - - + + - - + + - - - - - - - - - + + + + + + - - + - + @@ -64,29 +64,23 @@ - - - + diff --git a/tools/rna_tools/vienna_rna/rnasnoop.xml b/tools/rna_tools/vienna_rna/rnasnoop.xml index eab1b07b30..bfb586d5cf 100644 --- a/tools/rna_tools/vienna_rna/rnasnoop.xml +++ b/tools/rna_tools/vienna_rna/rnasnoop.xml @@ -1,16 +1,15 @@ - - Find targets of a query H/ACA snoRNA - + + Find targets of a query H/ACA snoRNA RNAsnoop macros.xml - - - - - '$output' + + + + + '$output' --alignmentLength=$length $constraint --energy-threshold=$energyThreshold @@ -42,11 +41,10 @@ #end if ]]> - - - + + @@ -58,81 +56,75 @@ - - - - - + + + - - - + + + - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + + + + - - - filetypeOptions['filetypeSelector'] == "fasta" + + + filetypeOptions['filetypeSelector'] == "fasta" - - - - + + + + + + - -' brackets represent snoRNA intramolecular interactions, while the '()' brackets represent intermolecular interactions between the snoRNA and its target. -The range of the structure in the two sequences in the format "from,to : from,to"; the energy of duplex structure in kcal/mol. If available the opening energy are also returned. - - +- Optimal and suboptimal hybridization structures, one per line. Each line contains the structure in dot-bracket format with a "&" separating the two strands, the range in both sequences, and the energy in kcal/mol. +- For FASTA input: PostScript structure plots bundled in a tar file ]]> - + diff --git a/tools/rna_tools/vienna_rna/rnasubopt.xml b/tools/rna_tools/vienna_rna/rnasubopt.xml index f583bade34..89d74d81a8 100644 --- a/tools/rna_tools/vienna_rna/rnasubopt.xml +++ b/tools/rna_tools/vienna_rna/rnasubopt.xml @@ -1,24 +1,26 @@ - - Calculates suboptimal secondary structures of RNAs + + Calculate suboptimal secondary structures of RNAs RNAsubopt macros.xml - - - - - + + + + '$output' -T$temperature --dangles=$dangling #if $methodOption.methodSelector == "range" - --deltaEnergy=$methodOption.deltaenergy + #if $methodOption.deltaenergy + --deltaEnergy=$methodOption.deltaenergy + #end if #else --stochBT=$methodOption.stochastic #end if #if $outputOption.outputSelector == "yes" - --deltaEnergyPost=$deltaenergypost + --deltaEnergyPost=$outputOption.deltaenergypost #end if $sorted $dos @@ -31,7 +33,7 @@ $advancedOptions.notetra $advancedOptions.logml #end if - #if $constraints.maxBPspan <> -1 + #if $constraints.maxBPspan != -1 --maxBPspan=$constraints.maxBPspan #end if #if str($constraints.constraintLocation.constraintSelector) == "fromFile" @@ -67,91 +69,81 @@ #end if ]]> - - - - + + + - - - - - + + + - - - + + + - + - + - - - - + + + - + - - - - + + + - - - - - - - - - + + + + + + + + -
- + - - + - - + - - - + + + - - + - - + + - + - + @@ -161,20 +153,18 @@ - + - - + + - - + - - + @@ -185,51 +175,41 @@ - - + - - + -
+
- + - + - - - + diff --git a/tools/rna_tools/vienna_rna/rnaup.xml b/tools/rna_tools/vienna_rna/rnaup.xml index 44cc87006b..a2f643e8aa 100644 --- a/tools/rna_tools/vienna_rna/rnaup.xml +++ b/tools/rna_tools/vienna_rna/rnaup.xml @@ -1,14 +1,14 @@ - + Calculate the thermodynamics of RNA-RNA interactions RNAup macros.xml - - - - - + + + + '$output' -T$temperature --dangles=$dangling @@ -32,90 +32,75 @@ && tar -cf '$accesibilitiesFile' *.out ]]> - - - - + + + - - - - - - - - - + + + + + + + + + - - - - - - + + + + + + - - - + + + - - - - - - - - + + + + + + + - - + + - + - - - + diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps index 7330968a04..eb60f267b7 100644 Binary files a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps and b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps differ diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps index 11236f8039..beaa6e77f8 100644 Binary files a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps and b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps differ diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps index 31790d11fe..506161269d 100644 Binary files a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps and b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps differ diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps index 6f63505280..6896ab562d 100644 Binary files a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps and b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps differ diff --git a/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt index f08c9e6e10..2dad8b4ee4 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt @@ -1 +1 @@ -(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))). 1,73 : 1,73 (-40.30) +.((.(((((...(((((((((((.(((((.(((((((&.)).)))))...))))))))))).))))).))))))) 37,73 : 37,73 (-36.65) diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt index a7024a007e..ee64b603a8 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt @@ -1,2 +1,2 @@ GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25) +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 + -0.75) diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt index ab88d7b301..8c3eb618f8 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt @@ -1,6 +1,6 @@ GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25) -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-26.77] -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 + -0.25 d=1.28} -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 + -0.25 MEA=70.93} - frequency of mfe structure in ensemble 0.773705; ensemble diversity 2.40 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 + -0.75) +.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))}),. [-25.20] +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. {-24.55 = -23.80 + -0.75 d=3.22} +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. {-24.55 = -23.80 + -0.75 MEA=68.37} + frequency of mfe structure in ensemble 0.58808; ensemble diversity 4.65 diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt index a7024a007e..ee64b603a8 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt @@ -1,2 +1,2 @@ GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25) +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 + -0.75) diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt index a7024a007e..ee64b603a8 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt @@ -1,2 +1,2 @@ GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25) +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 + -0.75) diff --git a/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt index 396724bb31..1c43449c2a 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt @@ -1,3 +1,3 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-A +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA .((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90) diff --git a/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt index f03f5ffc4b..edb7e3cd82 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt @@ -1,102 +1,102 @@ > comment 1 -0 0.0407267 -1 0.0435052 -2 0.0470227 -3 0.0505646 -4 0.0553391 -5 0.0603894 -6 0.0662047 -7 0.0718158 -8 0.0782007 -9 0.0863514 -10 0.0950516 -11 0.10505 -12 0.115613 -13 0.128245 -14 0.141712 -15 0.157281 -16 0.17497 -17 0.195056 -18 0.216799 -19 0.241743 -20 0.270432 -21 0.302132 -22 0.337644 -23 0.377263 -24 0.421546 -25 0.470799 -26 0.525589 -27 0.587016 -28 0.653829 -29 0.726606 -30 0.806458 -31 0.892656 -32 0.984857 -33 1.08272 -34 1.18601 -35 1.29332 -36 1.40305 -37 1.51467 -38 1.62618 -39 1.73524 -40 1.84032 -41 1.9407 -42 2.03385 -43 2.11859 -44 2.19443 -45 2.26182 -46 2.31999 -47 2.36969 -48 2.41182 -49 2.44826 -50 2.47967 -51 2.50769 -52 2.534 -53 2.55942 -54 2.5851 -55 2.61217 -56 2.64151 -57 2.67329 -58 2.70759 -59 2.74465 -60 2.78458 -61 2.8279 -62 2.8742 -63 2.92425 -64 2.97698 -65 3.03283 -66 3.09163 -67 3.15591 -68 3.23033 -69 3.3067 -70 3.38122 -71 3.45791 -72 3.54606 -73 3.63843 -74 3.73392 -75 3.83847 -76 3.94646 -77 4.05462 -78 4.16571 -79 4.28366 -80 4.39944 -81 4.50863 -82 4.61035 -83 4.70186 -84 4.78345 -85 4.85204 -86 4.90509 -87 4.9392 -88 4.95425 -89 4.95214 -90 4.93688 -91 4.91166 -92 4.87691 -93 4.8314 -94 4.78561 -95 4.75271 -96 4.71866 -97 4.66056 -98 4.57671 -99 4.48395 -100 4.39006 +0 0.0407267 +1 0.0435052 +2 0.0470227 +3 0.0505646 +4 0.0553391 +5 0.0603894 +6 0.0662047 +7 0.0718158 +8 0.0782007 +9 0.0863514 +10 0.0950516 +11 0.10505 +12 0.115613 +13 0.128245 +14 0.141712 +15 0.157281 +16 0.17497 +17 0.195056 +18 0.216799 +19 0.241743 +20 0.270432 +21 0.302132 +22 0.337644 +23 0.377263 +24 0.421546 +25 0.470799 +26 0.525589 +27 0.587016 +28 0.653829 +29 0.726606 +30 0.806458 +31 0.892656 +32 0.984857 +33 1.08272 +34 1.18601 +35 1.29332 +36 1.40305 +37 1.51467 +38 1.62618 +39 1.73524 +40 1.84032 +41 1.9407 +42 2.03385 +43 2.11859 +44 2.19443 +45 2.26182 +46 2.31999 +47 2.36969 +48 2.41182 +49 2.44826 +50 2.47967 +51 2.50769 +52 2.534 +53 2.55942 +54 2.5851 +55 2.61217 +56 2.64151 +57 2.67329 +58 2.70759 +59 2.74465 +60 2.78458 +61 2.8279 +62 2.8742 +63 2.92425 +64 2.97698 +65 3.03283 +66 3.09163 +67 3.15591 +68 3.23033 +69 3.3067 +70 3.38122 +71 3.45791 +72 3.54606 +73 3.63843 +74 3.73392 +75 3.83847 +76 3.94646 +77 4.05462 +78 4.16571 +79 4.28366 +80 4.39944 +81 4.50863 +82 4.61035 +83 4.70186 +84 4.78345 +85 4.85204 +86 4.90509 +87 4.9392 +88 4.95425 +89 4.95214 +90 4.93688 +91 4.91166 +92 4.87691 +93 4.8314 +94 4.78561 +95 4.75271 +96 4.71866 +97 4.66056 +98 4.57671 +99 4.48395 +100 4.39006 diff --git a/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt index 650ed23cab..1b0a1a5f90 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt @@ -1,4 +1,9 @@ -(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 17 - 73 -((((........)))). ( -5.10) 10 - 26 +.(((..((((....)))).))). ( -3.40) 51 - 73 +.((((..(((((.......)))))..)))). (-11.55) 42 - 72 +.((.(((((...(((((.......))))).))))))) (-13.35) 37 - 73 +.(.(((((.......))))).). ( -7.20) 24 - 46 +.((.(((((.......)))))..)). ( -7.90) 23 - 48 +.((.((((....)))).)). ( -4.70) 18 - 37 +.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 16 - 73 +.((((........)))). ( -5.30) 9 - 26 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA - diff --git a/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt index c94f1c34fb..b1ac8d3fda 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt @@ -1,28 +1,24 @@ >Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 -.((((....)))). ( -0.10) 56 .(((..((((....)))).))). ( -3.40) 51 -.(((((.......))))). ( -7.70) 48 .((((..(((((.......)))))..)))). (-10.30) 42 -.(((((...(((((.......))))).))))). (-11.50) 40 .((.(((((...(((((.......))))).))))))) (-12.10) 37 -.(((((.......))))). ( -5.80) 26 +.(.(((((.......))))).). ( -6.00) 24 .((.(((((.......)))))..)). ( -6.70) 23 -.((((....)))). ( -3.20) 21 .((.((((....)))).)). ( -4.70) 18 -.((((........)))). ( -5.30) 9 +.((((.(((.(.((((....))))).))).)))). (-10.50) 10 +.(((....((((........)))).(((((.......))))).....(((((.......)))))....))). (-20.70) 2 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA (-22.00) >Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 .(((..((((....)))).))). ( -3.40) 51 -.(((((.......))))). ( -9.20) 48 .((((..(((((.......)))))..)))). (-11.80) 42 -.(((((...(((((.......))))).))))). (-13.30) 40 .((.(((((...(((((.......))))).))))))) (-13.60) 37 -.(((((.......))))). ( -7.70) 26 +.(.(((((.......))))).). ( -7.90) 24 .((.(((((.......)))))..)). ( -8.60) 23 +.((.((((....)))).)). ( -4.70) 18 .(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-20.00) 16 -.((((........)))). ( -5.30) 9 +.(((....((((........)))).(((((.......))))).....(((((.......)))))....))). (-24.10) 2 (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) 1 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA (-29.60) diff --git a/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt index 719c2cc6e7..0516f3d3d9 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt @@ -1,6 +1,6 @@ >Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90) +.((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......))))))))))).. (-37.10) >Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54) +(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-44.70) diff --git a/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt index da8d4bacc7..51bb70413a 100644 --- a/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt +++ b/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt @@ -1,7 +1,8 @@ ->Anolis_caro_chrUn_GL343590.trna2-AlaAGC [0] -UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 [100] +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 1.00 (((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). -21.90 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00 ->Anolis_caro_chrUn_GL343207.trna3-AlaAGC [0] -GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 [100] +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 1.00 (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60