From fc778359a0ed8eff85677b41f45c5505d65a2c6b Mon Sep 17 00:00:00 2001
From: Bjoern Gruening <bjoern.gruening@gmail.com>
Date: Sun, 30 Aug 2026 12:51:10 +0200
Subject: [PATCH 1/4] add vienna_rna update

---
 tools/rna_tools/vienna_rna/kinfold.xml        |  84 +++--
 tools/rna_tools/vienna_rna/kinwalker.xml      | 133 ++++----
 tools/rna_tools/vienna_rna/macros.xml         |  27 +-
 tools/rna_tools/vienna_rna/rna2dfold.xml      |  72 ++---
 tools/rna_tools/vienna_rna/rnaaliduplex.xml   |  77 ++---
 tools/rna_tools/vienna_rna/rnaalifold.xml     | 285 ++++++++---------
 tools/rna_tools/vienna_rna/rnacofold.xml      | 183 +++++------
 tools/rna_tools/vienna_rna/rnadistance.xml    |  80 +++--
 tools/rna_tools/vienna_rna/rnaduplex.xml      |  68 ++--
 tools/rna_tools/vienna_rna/rnaeval.xml        |  90 +++---
 tools/rna_tools/vienna_rna/rnafold.xml        | 296 ++++++++----------
 tools/rna_tools/vienna_rna/rnaheat.xml        |  72 ++---
 tools/rna_tools/vienna_rna/rnainverse.xml     |  67 ++--
 tools/rna_tools/vienna_rna/rnalalifold.xml    |  76 ++---
 tools/rna_tools/vienna_rna/rnalfold.xml       |  79 +++--
 tools/rna_tools/vienna_rna/rnapaln.xml        |  89 +++---
 tools/rna_tools/vienna_rna/rnapdist.xml       |  80 +++--
 tools/rna_tools/vienna_rna/rnapkplex.xml      |  78 ++---
 tools/rna_tools/vienna_rna/rnaplex.xml        | 133 ++++----
 tools/rna_tools/vienna_rna/rnaplfold.xml      | 125 ++++----
 tools/rna_tools/vienna_rna/rnaplot.xml        |  72 ++---
 tools/rna_tools/vienna_rna/rnasnoop.xml       | 116 ++++---
 tools/rna_tools/vienna_rna/rnasubopt.xml      | 152 ++++-----
 tools/rna_tools/vienna_rna/rnaup.xml          | 103 +++---
 ...lis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps | Bin 8308 -> 14986 bytes
 ...lis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps | Bin 6090 -> 7046 bytes
 ...lis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps | Bin 11400 -> 18078 bytes
 ...lis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps | Bin 6083 -> 7039 bytes
 .../test-data/mfe_struct_result.fasta         |   6 +-
 .../test-data/rnaaliduplex_result1.txt        |   2 +-
 .../test-data/rnaalifold_result1.txt          |   2 +-
 .../test-data/rnaalifold_result_MEA.txt       |  10 +-
 .../test-data/rnaalifold_resultfa.txt         |   2 +-
 .../test-data/rnaalifold_resultstk.txt        |   2 +-
 .../test-data/rnacofold_result1.txt           |   2 +-
 .../vienna_rna/test-data/rnaheat_result1.txt  | 202 ++++++------
 .../test-data/rnalalifold_result1.txt         |  11 +-
 .../vienna_rna/test-data/rnalfold_result1.txt |  16 +-
 .../test-data/rnapkplex_result1.txt           |   4 +-
 .../test-data/rnasubopt_result1.txt           |   9 +-
 .../test-data/trajectory_result.tabular       |  10 -
 41 files changed, 1310 insertions(+), 1605 deletions(-)

diff --git a/tools/rna_tools/vienna_rna/kinfold.xml b/tools/rna_tools/vienna_rna/kinfold.xml
index a98ec96fc0..1371135a5d 100644
--- a/tools/rna_tools/vienna_rna/kinfold.xml
+++ b/tools/rna_tools/vienna_rna/kinfold.xml
@@ -1,18 +1,18 @@
-<tool id="viennarna_kinfold" name="@EXECUTABLE@" version="1.3.0.0">
-    <description>Simulates the stochastic folding kinetics of RNA sequences into secondary structures.</description>
+<tool id="viennarna_kinfold" name="Kinfold" version="1.3.0.0" profile="@PROFILE@">
+    <description>Simulate stochastic folding kinetics of RNA sequences</description>
     <macros>
         <token name="@EXECUTABLE@">Kinfold</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
         Kinfold < '$input'
         -T$Temp
         --dangle=$dangle
-        $logML       
+        $logML
         $move_set_options.noShift
         $move_set_options.noLP
         --num=$simulation_options.num
@@ -21,84 +21,72 @@
         --glen=$simulation_options.glen
         $simulation_options.fpt
         $simulation_options.met
-        $output_options.lmin        
+        $output_options.lmin
         --cut=$output_options.cut
         > '$output'
         && cat *.log > '$log'
 ]]>
     </command>
-
     <inputs>
-        <param format="txt" name="input" type="data" label="Fasta file"/>
-        <param argument="--Temp" type="float" value="37.0" label="temperature [°C]"/>
-        <param argument="--dangle" type="select" label="how to treat dangling end energies">
+        <param format="txt" name="input" type="data" label="Input file"/>
+        <param argument="--Temp" name="Temp" type="float" value="37.0" label="Temperature [°C]"/>
+        <param argument="--dangle" name="dangle" type="select" label="How to treat dangling end energies">
             <option value="0">0: none</option>
             <option value="2" selected="true">2: double</option>
             <option value="1">1: normal</option>
         </param>
-        <param argument="--logML" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Logarithmic energy functions for multi-loops"/>
-        
+        <param argument="--logML" name="logML" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Logarithmic energy functions for multi-loops"/>
         <section name="move_set_options" title="Move set options">
-            <param argument="--noShift" type="boolean" truevalue="" falsevalue="--noShift" checked="true" label="Turn on shift moves."/>
-            <param argument="--noLP" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow structures containing isolated base-pairs"/>
+            <param argument="--noShift" name="noShift" type="boolean" truevalue="" falsevalue="--noShift" checked="true" label="Turn on shift moves"/>
+            <param argument="--noLP" name="noLP" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow structures containing isolated base-pairs"/>
         </section>
-        
-        <section name="simulation_options" title="Simulation options" >
-            <param argument="--num" type="integer" value="1" label="Number of trajectories to compute" help="" optional="true"/>
-            <param argument="--time" type="float" value="500.0" label="Set maximum length of folding trajectory" help="The default (500) is very short and meant for testing purposes only." optional="true"/>
-            <param argument="--grow" type="float" value="0" label="Simulate folding during transcription with a chain growth event taking place every rate timesteps." help="" optional="true"/>
-            <param argument="--glen" type="integer" value="15" label="Start a folding during transcription simulation with an inital chain length of len."  help="" optional="true" />
-            <param argument="--fpt" type="boolean" truevalue="--fpt" falsevalue="" checked="true" label="compute first passage time" help="stop when a stop-structure is reached"/>
-            <param argument="--met" type="boolean" truevalue="--met" falsevalue="" checked="false" label="Use the Metropolis rule for rate between two neighboring conformations" help="Use the Metropolis rule for rate between two neighboring conformations, i.e. k=min{1,exp(−dE/RT)}. By default Kinfold uses the symmetric Kawasaki rule k=exp(−dE/2RT)."/>
+        <section name="simulation_options" title="Simulation options">
+            <param argument="--num" name="num" type="integer" value="1" optional="true" label="Number of trajectories to compute"/>
+            <param argument="--time" name="time" type="float" value="500.0" optional="true" label="Set maximum length of folding trajectory" help="The default (500) is very short and meant for testing purposes only."/>
+            <param argument="--grow" name="grow" type="float" value="0" optional="true" label="Simulate folding during transcription" help="Chain growth event taking place every rate timesteps."/>
+            <param argument="--glen" name="glen" type="integer" value="15" optional="true" label="Initial chain length for transcription simulation"/>
+            <param argument="--fpt" name="fpt" type="boolean" truevalue="--fpt" falsevalue="" checked="true" label="Compute first passage time" help="Stop when a stop-structure is reached."/>
+            <param argument="--met" name="met" type="boolean" truevalue="--met" falsevalue="" checked="false" label="Use the Metropolis rule for rate between two neighboring conformations" help="Use k=min{1,exp(-dE/RT)}. By default Kinfold uses the symmetric Kawasaki rule k=exp(-dE/2RT)."/>
         </section>
-        
         <section name="output_options" title="Output Options">
-            <param argument="--lmin" type="boolean" truevalue="--lmin" falsevalue="" checked="false" label="Don’t print complete trajectory, but only local minimas encountered" help=""/>
-            <param argument="--cut" type="float" value="20.0" label="Cutoff energy" help="Print only those parts of the trajectory that stays below energy." optional="true"/>
+            <param argument="--lmin" name="lmin" type="boolean" truevalue="--lmin" falsevalue="" checked="false" label="Print only local minima encountered"/>
+            <param argument="--cut" name="cut" type="float" value="20.0" optional="true" label="Cutoff energy" help="Print only those parts of the trajectory that stay below this energy."/>
         </section>
-       
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
-        <data format="log" name="log"/>
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
+        <data format="txt" name="log" label="${tool.name} log on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="kinfold_input.txt"/>
             <output name="output">
                 <assert_contents>
-                    <has_text text="..............." />
+                    <has_text text="..............."/>
                 </assert_contents>
             </output>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **Kinfold**
 
-The program Kinfold simulates the stochastic folding kinetics of RNA sequences into secondary structures. Folding trajectories are simulated using a Monte Carlo procedure using the formation, and dissociation of individual base pairs, and (optionally) the shifting of individual base pairs.
+Simulates the stochastic folding kinetics of RNA sequences into secondary structures. Folding trajectories are simulated using a Monte Carlo procedure using the formation and dissociation of individual base pairs, and (optionally) the shifting of individual base pairs.
 
-Note that all times are given in internal units that can be translated into real time only by copmparison with experiment. Very roughly one time step corresponds to about 1e−7 seconds.
+Note that all times are given in internal units that can be translated into real time only by comparison with experiment. Very roughly one time step corresponds to about 1e-7 seconds.
 
 -----
 
 **Input format**
 
-Input consists of an RNA sequence, optionally followed by the initial structure and one or more stop structures in dot−bracket notation. 
+Input consists of an RNA sequence, optionally followed by the initial structure and one or more stop structures in dot-bracket notation.
 
-------
+-----
 
 **Outputs**
 
-- Trajecotires: 
-
-The trajectory lists stucture, energy, and time for each simulation step. The X1 signifies that the trajectory terminated in the first stop structure
-
-- A log file containing summary information for each trajectory:
-
-The logfile would contain information needed to reproduce the simulation results such as options and random seeds used.
+- Trajectories: lists structure, energy, and time for each simulation step
+- A log file containing summary information (options and random seeds) for each trajectory
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/kinwalker.xml b/tools/rna_tools/vienna_rna/kinwalker.xml
index c06007a22c..069cb36e8a 100644
--- a/tools/rna_tools/vienna_rna/kinwalker.xml
+++ b/tools/rna_tools/vienna_rna/kinwalker.xml
@@ -1,132 +1,123 @@
-<tool id="viennarna_kinwalker" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>cotranscriptional folding of RNAs</description>
+<tool id="viennarna_kinwalker" name="Kinwalker" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Simulate cotranscriptional folding of RNAs</description>
     <macros>
         <token name="@EXECUTABLE@">kinwalker</token>
         <import>macros.xml</import>
     </macros>
-     <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <command detect_errors="aggressive"><![CDATA[
     head -n 1 '$input_sequence' | head -c -1 -q  > seq.ident
     &&
-    sed '1d' '$input_sequence' > input.seq
-    &&
     kinwalker
         $init_structure
         $interrupt
-        ##$printfront
-        
         --barrier_heuristic $barrier_heuristic.used
-        
         #if $barrier_heuristic.used == "M"
             --grouping $barrier_heuristic.grouping
             --lookahead $barrier_heuristic.lookahead
         #else if $barrier_heuristic.used == "B"
             --maxkeep $barrier_heuristic.maxkeep
         #end if
-        
         --dangle $dangle
         --noLonelyPairs $noLonelyPairs
         --transcribed $transcribed
         --transcription_rate $transcription_rate
         --windowsize $windowsize
-        
-        < input.seq
-        
+        < '$input_sequence'
         > blah
-         
-        &&
-        sed -n '2s/[\.\(\)]\+\s\+\(.\+\)$/ mfe: \1/p' blah > energy
-        
-        &&
-        cat seq.ident energy > '$mfe_struct'
-        
-        &&
-        sed -e '2s/^\([\.\(\)]\+\).*$/\1/' -ne '1,2p' blah >> '$mfe_struct'
-        
-        &&
-        sed -e 's/[ \t]*$//' -ne '/TRAJ/,/Kinwal/ {/TRAJ/n;/Kinwal/!{s/\s/\t/gp}}' blah > '$trajectory'
+    &&
+    sed -n '2s/[\.\(\)]\+\s\+\(.\+\)$/ mfe: \1/p' blah > energy
+    &&
+    cat seq.ident energy > '$mfe_struct'
+    &&
+    sed -e '2s/^\([\.\(\)]\+\).*$/\1/' -ne '1,2p' blah >> '$mfe_struct'
+    &&
+    sed -e 's/[ \t]*$//' -ne '/TRAJ/,/Kinwal/ {/TRAJ/n;/Kinwal/!{s/\s/\t/gp}}' blah > '$trajectory'
 ]]>
     </command>
     <inputs>
         <param name="input_sequence" format="fasta" type="data" label="Input sequence" help="A single sequence in FASTA format"/>
-        <param name="init_structure" type="boolean" truevalue="--init_structure" falsevalue="" checked="false" label="Start with a structure other than the open chain" help="(--init_structure)"/>
-        <param name="interrupt" type="boolean" truevalue="--interrupt" falsevalue="" checked="false" label="Allow interrupted folding trajectories when the barrier is exceeded" help="(--interrupt)"/>
-        <!-- need to implement with dataset collections <param name="printfront" type="boolean" truevalue="!doublehypen!printfront" falsevalue="" checked="true" label="Creates PS plots of front progression" help="(!doublehypen!printfront)"/> -->
+        <param argument="--init_structure" type="boolean" truevalue="--init_structure" falsevalue="" checked="false" label="Start with a structure other than the open chain"/>
+        <param argument="--interrupt" type="boolean" truevalue="--interrupt" falsevalue="" checked="false" label="Allow interrupted folding trajectories when the barrier is exceeded"/>
         <conditional name="barrier_heuristic">
-            <param name="used" type="select" label="Barrier Heuristic" help="(--barrier_heuristic)">
+            <param argument="--barrier_heuristic" name="used" type="select" label="Barrier Heuristic">
                 <option value="M" selected="true">Morgan-Higgs</option>
                 <option value="S">Limit small stacks</option>
                 <option value="B">Barriers</option>
                 <option value="A">All</option>
             </param>
             <when value="M">
-                <param name="grouping" type="select" label="How to treat conflict groups" help="(--grouping)">
+                <param argument="--grouping" type="select" label="How to treat conflict groups">
                     <option value="standard" selected="true">Standard</option>
                     <option value="regroup">Re-group</option>
                 </param>
-                <param name="lookahead" type="integer" value="1" label="Number of basepairs that MorganHiggs forms its subpaths from" help="(--lookahead)"/>
+                <param argument="--lookahead" type="integer" value="1" label="Number of base pairs that MorganHiggs forms its subpaths from"/>
             </when>
-            <when value="S" />
+            <when value="S"/>
             <when value="B">
-                <param name="maxkeep" type="integer" value="1" label="Breadth of breadth first search" help="(--maxkeep)"/>
+                <param argument="--maxkeep" type="integer" value="1" label="Breadth of breadth-first search"/>
             </when>
-            <when value="A" />
+            <when value="A"/>
         </conditional>
-        <param name="dangle" type="select" label="Dangle value as in VienneRNA package" help="(--dangle)">
+        <param argument="--dangle" type="select" label="Dangle value">
             <option value="0" selected="true">0</option>
             <option value="1">1</option>
             <option value="2">2</option>
         </param>
-        <param name="noLonelyPairs" type="integer" value="2" label="Value of noLonelyPairs as in ViennaRNA" help="(--noLonelyPairs)"/>
-        
-        <param name="transcribed" type="integer" value="1" label="Number of bases initially transcribed" help="0 means all is transcribed (--transcribed)"/>
-        <param name="transcription_rate" type="float" value="200" label="Number of bases transcribed per second" help="(--transcription_rate)"/>
-        <param name="windowsize" type="integer" value="0" label="Max size of substructures considered for folding events during transcription" help="0= all are considered. (--windowsize)"/>
+        <param argument="--noLonelyPairs" type="integer" value="2" label="Value of noLonelyPairs"/>
+        <param argument="--transcribed" type="integer" value="1" label="Number of bases initially transcribed" help="0 means all are transcribed"/>
+        <param argument="--transcription_rate" type="float" value="200" label="Number of bases transcribed per second"/>
+        <param argument="--windowsize" type="integer" value="0" label="Max size of substructures considered for folding events during transcription" help="0 = all are considered"/>
     </inputs>
     <outputs>
-        <data format="fasta" name="mfe_struct" label="MFE structure from ${tool.name} on ${on_string}" />
-        <data format="tabular" name="trajectory" label="Trajectory of ${tool.name} on ${on_string}" />
+        <data format="fasta" name="mfe_struct" label="MFE structure from ${tool.name} on ${on_string}"/>
+        <data format="tabular" name="trajectory" label="Trajectory of ${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
-            <param name="input_sequence" value="test_sequence_input.fasta" />
-            <param name="init_structure" value="" />
-            <param name="interrupt" value="" />
-            <param name="used" value="M" />
-            <param name="grouping" value="standard" />
-            <param name="lookahead" value="1" />
-            <param name="dangle" value="0" />
-            <param name="noLonelyPairs" value="2" />
-            <param name="transcribed" value="1" />
-            <param name="transcription_rate" value="200" />
-            <param name="windowsize" value="0" />
-            <output name="mfe_struct" file="mfe_struct_result.fasta" />
-            <output name="trajectory" file="trajectory_result.tabular" />
+        <test expect_num_outputs="2">
+            <param name="input_sequence" value="test_sequence_input.fasta"/>
+            <param name="init_structure" value="false"/>
+            <param name="interrupt" value="false"/>
+            <conditional name="barrier_heuristic">
+                <param name="used" value="M"/>
+                <param name="grouping" value="standard"/>
+                <param name="lookahead" value="1"/>
+            </conditional>
+            <param name="dangle" value="0"/>
+            <param name="noLonelyPairs" value="2"/>
+            <param name="transcribed" value="1"/>
+            <param name="transcription_rate" value="200"/>
+            <param name="windowsize" value="0"/>
+            <output name="mfe_struct" file="mfe_struct_result.fasta"/>
+            <output name="trajectory" file="trajectory_result.tabular"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-**What it does**
+    <help format="markdown"><![CDATA[
+**Kinwalker**
 
-Kinwalker splits the folding process into a series of events where each event can either be a folding event or a transcription event. In each transcription event one base from the RNA sequence is appended to the already transcribed and (partially) folded subsequence. 
-Kinwalker executes transcription events at regular time intervals. In each folding event a subsequence of the already transcribed RNA sequence is selected and a new structure is formed by combining base pairs from the current structure with base pairs from the mfE structure of that subsequence. 
+Kinwalker splits the folding process into a series of events where each event can either be a folding event or a transcription event. In each transcription event one base from the RNA sequence is appended to the already transcribed and (partially) folded subsequence.
 
-This is done in such a way that the new structure includes base pairs from both structures in an energetically favorable manner. Kinwalker estimates the waiting times for individual folding events depending on the height of the energy barrier between the current structure and the new structure into which the molecule is folded. Folding events between structures can only occur, if the energy barrier between them is less than the maximum allowed energy barrier. 
+Kinwalker executes transcription events at regular time intervals. In each folding event a subsequence of the already transcribed RNA sequence is selected and a new structure is formed by combining base pairs from the current structure with base pairs from the mfe structure of that subsequence.
 
-As folding paths can only be calculated exhaustively for short sequences (n>100), heuristic approaches have to be employed which explicitly construct a (re)folding path between the two structures. The saddle height is then estimated as the highest point along the path. The best known algorithm for approximating saddle heights between RNA conformations is the Morgan-Higgs heuristic, which tries to find a folding path from an origin secondary structure to a target secondary structure where the maximum height along the path is minimal. The  heuristic models state transitions at base pair resolution.
-]]>
+This is done in such a way that the new structure includes base pairs from both structures in an energetically favorable manner. Kinwalker estimates the waiting times for individual folding events depending on the height of the energy barrier between the current structure and the new structure. Folding events between structures can only occur if the energy barrier between them is less than the maximum allowed energy barrier.
+
+As folding paths can only be calculated exhaustively for short sequences, heuristic approaches have to be employed which explicitly construct a (re)folding path between the two structures. The best known algorithm for approximating saddle heights between RNA conformations is the Morgan-Higgs heuristic.
 
-**Input**
+-----
 
-RNA sequence in FASTA format
+**Input format**
 
-**Output**
+A single RNA sequence in FASTA format.
 
-RNA folding trajectory
+-----
 
+**Outputs**
+
+- MFE structure in FASTA format
+- Folding trajectory in tabular format
+]]>
     </help>
     <citations>
         <citation type="doi">10.1016/j.jmb.2008.02.064</citation>
diff --git a/tools/rna_tools/vienna_rna/macros.xml b/tools/rna_tools/vienna_rna/macros.xml
index 262db0d6f5..f1b8bf84ae 100644
--- a/tools/rna_tools/vienna_rna/macros.xml
+++ b/tools/rna_tools/vienna_rna/macros.xml
@@ -1,24 +1,29 @@
 <macros>
+    <token name="@TOOL_VERSION@">2.7.2</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <token name="@PROFILE@">25.0</token>
     <xml name="requirements">
         <requirements>
-            <requirement type="package" version="2.2.10">viennarna</requirement>
+            <requirement type="package" version="@TOOL_VERSION@">viennarna</requirement>
             <yield/>
         </requirements>
     </xml>
-    <token name="@VERSION@">2.2.10</token>
     <xml name="version_command">
         <version_command>@EXECUTABLE@ --version</version_command>
     </xml>
-
-    <xml name="stdio">
-        <stdio>
-            <exit_code range="1:" />
-            <exit_code range=":-1" />
-            <regex match="Error:" />
-            <regex match="Exception:" />
-        </stdio>
+    <xml name="xrefs">
+        <xrefs>
+            <xref type="bio.tools">viennarna</xref>
+        </xrefs>
+    </xml>
+    <xml name="creator">
+        <creator>
+            <person givenName="Björn" familyName="Grüning" url="https://github.com/bgruening" identifier="https://orcid.org/0000-0002-3079-6586"/>
+            <person givenName="Milad" familyName="Miladi" url="https://github.com/miladi"/>
+            <person givenName="Jörg" familyName="Fallmann" url="https://github.com/jfallmann"/>
+            <person givenName="Simon" familyName="Bray" url="https://github.com/simonbray"/>
+        </creator>
     </xml>
-
     <xml name="citations">
         <citations>
             <citation type="doi">10.1186/1748-7188-6-26</citation>
diff --git a/tools/rna_tools/vienna_rna/rna2dfold.xml b/tools/rna_tools/vienna_rna/rna2dfold.xml
index c4d346ee2d..9ed8932145 100644
--- a/tools/rna_tools/vienna_rna/rna2dfold.xml
+++ b/tools/rna_tools/vienna_rna/rna2dfold.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rna2dfold" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>explore structure space between two reference structures</description>
+<tool id="viennarna_rna2dfold" name="RNA2Dfold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Explore structure space between two reference structures</description>
     <macros>
         <token name="@EXECUTABLE@">RNA2Dfold</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
         RNA2Dfold -T $temperature -d $dangling --stochBT=$nrbt
         #if int($nk) > -1 and int($nl) > -1
             --neighborhood=$nk:$nl
@@ -21,7 +21,7 @@
         $advancedOptions.noclosinggu
         $advancedOptions.notetra
         $advancedOptions.circ
-        #if $varExists('$advancedOptions.maxK')    
+        #if $varExists('$advancedOptions.maxK')
             --maxDist1=$advancedOptions.maxK
             --maxDist2=$advancedOptions.maxL
         #end if
@@ -29,17 +29,16 @@
 ]]>
     </command>
     <inputs>
-        <param format="txt,dbn" name="custom_input" type="data" label="Custom File"/>
+        <param format="txt,dbn" name="custom_input" type="data" label="Custom input file"/>
         <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
-        <param name="nrbt" type="integer" value="1" label="Number of backtrack of Boltzmann samples" help="--stochBT=INT"/>
-        <param name="nk" type="integer" value="-1" label="[k]: Distance to first reference structure of neighborhood in which to backtrack" help="--neighborhood=k:l"/>
-        <param name="nl" type="integer" value="-1" label="[l]: Distance to second reference structure of neighborhood in which to backtrack" help="--neighborhood=k:l"/>
+        <param name="nrbt" type="integer" value="1" label="Number of Boltzmann backtrack samples" help="--stochBT"/>
+        <param name="nk" type="integer" value="-1" label="[k]: Distance to first reference structure for neighborhood backtracking" help="--neighborhood=k:l"/>
+        <param name="nl" type="integer" value="-1" label="[l]: Distance to second reference structure for neighborhood backtracking" help="--neighborhood=k:l"/>
         <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="2" selected="true">Unpaired bases participate in all dangling ends (2)</option>
             <option value="0">Ignore dangling ends (0)</option>
         </param>
-        <param name="noBT" type="boolean" checked="true" truevalue="" falsevalue="--noBT" 
-            label="Backtrack structures, don't calculate energy contributions only" argument="--noBT"/>
+        <param argument="--noBT" name="noBT" type="boolean" checked="true" truevalue="" falsevalue="--noBT" label="Backtrack structures (don't calculate energy contributions only)"/>
         <conditional name="pfselect">
             <param name="pf" type="select" label="Calculate partition function" help="--partfunc">
                 <option value="no">no</option>
@@ -48,61 +47,48 @@
             <when value="yes">
                 <param name="pfscaling" type="float" value="1.0" label="Scaling factor for the partition function"/>
             </when>
-            <when value="no">
-            </when>
+            <when value="no"/>
         </conditional>
         <section name="advancedOptions" title="Advanced options">
-            <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-            <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>
-            <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>                
-            <param argument="--circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Model as circular RNA structure"/>                                      
-            <param name="maxK" type="integer" value="10" max="44" label="Maximum distance to first reference structure" argument="--maxDist1"/>
-            <param name="maxL" type="integer" value="10" max="43" label="Maximum distance to second reference structure" argument="--maxDist2"/>
-            <!-- This argument causes "Segmentation fault"-->
-            <!-- <param name="nogu" type="boolean" truevalue="" falsevalue="- -noGU" checked="true" label="Allow GU pairing" help="Allow wobbly pairs G-U."/> -->               
+            <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+            <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
+            <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+            <param argument="--circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Model as circular RNA structure"/>
+            <param argument="--maxDist1" name="maxK" type="integer" value="10" max="44" label="Maximum distance to first reference structure"/>
+            <param argument="--maxDist2" name="maxL" type="integer" value="10" max="43" label="Maximum distance to second reference structure"/>
         </section>
     </inputs>
     <outputs>
-        <data format="dbn" name="out_file"/>
+        <data format="dbn" name="out_file" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="custom_input" value="rna2dfold_input1.txt"/>
             <param name="nrbt" value="0"/>
-            <output name="out_file1" file="rna2dfold_result1.txt"/>
+            <output name="out_file" file="rna2dfold_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNA2Dfold**
 
-The program partitions the secondary structure space into (basepair)distance
-classes according to two fixed reference structures. It expects a sequence and
-two secondary structures in dot-bracket notation as its inputs. For each
-distance class, the MFE representative, Boltzmann probabilities and Gibbs free
-energy is computed. Additionally, a stochastic backtracking routine allows to
-produce samples of representative suboptimal secondary structures from each
-partition.
-The k-distance corresponds to the distance to the first reference structure, and
-the l-distance corresponds to the distance to the second reference structure
+Partitions the secondary structure space into (base pair) distance classes according to two fixed reference structures. It expects a sequence and two secondary structures in dot-bracket notation as input. For each distance class, the MFE representative, Boltzmann probabilities and Gibbs free energy is computed. Additionally, a stochastic backtracking routine produces samples of representative suboptimal secondary structures from each partition.
 
 -----
 
 **Input format**
 
-RNA2Dfold requires one input file in the following format
+RNA2Dfold requires one input file in the following format:
 
 - 1st line: RNA sequence
 - 2nd line: first reference structure in dot-bracket format
 - 3rd line: second reference structure in dot-bracket format
 
-------
+-----
 
 **Outputs**
 
-- text output with several secondary structures and its energies
-
+- Text output with secondary structures and energies for each distance class
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaaliduplex.xml b/tools/rna_tools/vienna_rna/rnaaliduplex.xml
index b64d71eb93..480b6335f5 100644
--- a/tools/rna_tools/vienna_rna/rnaaliduplex.xml
+++ b/tools/rna_tools/vienna_rna/rnaaliduplex.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rnaaliduplex" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>find binding sites of two RNA alignments</description>
+<tool id="viennarna_rnaaliduplex" name="RNAaliduplex" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Find binding sites of two RNA alignments</description>
     <macros>
         <token name="@EXECUTABLE@">RNAaliduplex</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
         RNAaliduplex -T $temperature -d $dangling $flagsort --deltaEnergy=$deltaEnergy '$input1' '$input2'
         $advancedOptions.noconversion
         $advancedOptions.nolp
@@ -22,75 +22,54 @@
 ]]>
     </command>
     <inputs>
-        <param format="txt" name="input1" type="data" label="Clustal alignment file"/>
-        <param format="txt" name="input2" type="data" label="Clustal alignment file"/>
+        <param format="txt" name="input1" type="data" label="Clustal alignment file (first)"/>
+        <param format="txt" name="input2" type="data" label="Clustal alignment file (second)"/>
         <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
-        <param argument="--deltaEnergy" type="float" value="0.0" label="Compute suboptimal structures with energy in a certain range of the optimum [kcal/mol]" 
-            help="Default is calculation of mfe structure only."/>
-        <param name="dangling" type="select" label="How to treat dangling end energiesHow to treat dangling end energies for bases adjacent to helices in free ends and multi-loops" argument="-d">
+        <param argument="--deltaEnergy" type="float" value="0.0" label="Compute suboptimal structures within this energy range of the optimum [kcal/mol]"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" argument="-d">
             <option value="0">0: ignore dangling ends</option>
             <option value="1">1: unpaired bases participate in one dangling end only</option>
-            <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+            <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param name="flagsort" type="boolean" checked="false" label="Output will be sorted by free energy" truevalue="--sorted" falsevalue="" help="--sorted"/>
+        <param argument="--sorted" name="flagsort" type="boolean" checked="false" truevalue="--sorted" falsevalue="" label="Sort output by free energy"/>
         <section name="advancedOptions" title="Advanced options">
-            <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-            <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-            <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-            <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>
-            <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/> 
-            <param name="nsp" type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs." 
-                help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." 
-                argument="--nsp"/>
+            <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+            <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+            <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+            <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
+            <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+            <param argument="--nsp" name="nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs."/>
         </section>
     </inputs>
     <outputs>
-        <data format="dbn" name="out_file"/>
+        <data format="dbn" name="out_file" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input1" value="rnaaliduplex_input1.clustal"/>
             <param name="input2" value="rnaaliduplex_input1.clustal"/>
-            <output name="out_file1" file="rnaaliduplex_result1.txt"/>
+            <output name="out_file" file="rnaaliduplex_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAaliduplex**
 
-The program reads two alignments of RNA sequences in CLUSTAL format and
-predicts optimal and suboptimal binding sites, hybridization energies and the
-corresponding structures. The calculation takes only inter-molecular base pairs
-into account, for the general case use RNAcofold. The use of alignments allows
-to focus on binding sites that are evolutionary conserved. Note, that the two
-input alignments need to have an equal number of sequences and the same order,
-i.e. the 1st sequence in file1 will be hybridized to the 1st in file2 etc.
-
-The computed binding sites, energies, and structures are written to stdout, one
-structure per line. Each line consist of: The structure in dot bracket format
-with a &  separating the two strands. The range of the structure in the two
-sequences in the format  "from,to : from,to"; the energy of duplex structure
-in kcal/mol.
-The format is especially useful for computing the hybrid structure between a
-small probe sequence and a long target sequence.
-
-
+Reads two alignments of RNA sequences in CLUSTAL format and predicts optimal and suboptimal binding sites, hybridization energies and the corresponding structures. The calculation takes only inter-molecular base pairs into account; for the general case use RNAcofold. The use of alignments allows focusing on binding sites that are evolutionarily conserved. The two input alignments need to have an equal number of sequences in the same order.
 
 -----
 
 **Input format**
 
-RNAaliduplex takes two alignment files generated with Clustal (\*.aln).
-
+RNAaliduplex takes two alignment files in Clustal format (\*.aln).
 
 -----
 
 **Outputs**
 
-text output with several secondary structures and its energies
-
+- Text output with secondary structures and hybridization energies
+- Each line: structure in dot-bracket format with '&' separating strands, ranges in format "from,to : from,to", and energy in kcal/mol
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaalifold.xml b/tools/rna_tools/vienna_rna/rnaalifold.xml
index 74c6330c8d..9fcdb8380f 100644
--- a/tools/rna_tools/vienna_rna/rnaalifold.xml
+++ b/tools/rna_tools/vienna_rna/rnaalifold.xml
@@ -1,17 +1,18 @@
-<tool id="viennarna_rnaalifold" name="@EXECUTABLE@" version="@VERSION@.1">
+<tool id="viennarna_rnaalifold" name="RNAalifold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Calculate minimum free energy secondary structures and partition function on a multiple alignment file</description>
     <macros>
         <token name="@EXECUTABLE@">RNAalifold</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
-        
-        RNAalifold  < '$input' > '$tabularFile'
-        
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
+        ln -s '$input' ./input.${input.ext} &&
+
+        RNAalifold
+
         #if $input.ext == 'clustal':
             -f C
         #else if $input.ext == 'fasta':
@@ -26,30 +27,30 @@
         -T$model_options.temperature -d$model_options.dangling
         $general_options.verbose
         $general_options.color
-        $general_options.alignment
-        #if $general_options.layout_type ==0
+        $general_options.aln
+        #if $general_options.layout_type == 0
             --layout-type=$general_options.layout_type
         #end if
         $general_options.noPS
-        #if str($IDs.id_prefix) <> "alignment"
+        #if str($IDs.id_prefix) != "alignment"
             --id-prefix='$IDs.id_prefix'
         #end if
         $IDs.continuous_ids
         $IDs.auto_id
-        #if $IDs.id_digits <> 4
+        #if $IDs.id_digits != 4
             --id-digits=$IDs.id_digits
         #end if
-        #if $IDs.id_start <> 1
+        #if $IDs.id_start != 1
             --id-start=$IDs.id_start
         #end if
-        #if $constraints.maxBPspan <> -1
+        #if $constraints.maxBPspan != -1
             --maxBPspan=$constraints.maxBPspan
         #end if
         #if str($constraints.constraintLocation.constraintSelector) == "fromFile"
             --constraint='$constraints.constraintLocation.constraintsFile'
             $constraints.constraintLocation.batch
-            $constraints.ss_cons
-        #end if        
+            $constraints.SS_cons
+        #end if
         #if str($constraints.shapeOption.shapeSelector) == "isUsed"
             #if len($constraints.shapeOption.shape_files) > 0
                 #set $sf=list()
@@ -57,227 +58,193 @@
                     $sf.append(str('$i.shape'))
                 #end for
                 --shape= #echo ','.join($sf)
-                #if $constraints.shapeOption.m <> 1.8 or  $constraints.shapeOption.b <> -0.6
+                #if $constraints.shapeOption.m != 1.8 or $constraints.shapeOption.b != -0.6
                     #set $s="Dm"+str($constraints.shapeOption.m)+"b"+str($constraints.shapeOption.b)
                     --shapeMethod=$s
-                #end if		
+                #end if
             #end if
         #end if
 
-        #if $algorithm_options.pf <> "-1"
+        #if $algorithm_options.pf != "-1"
             --partfunc=$algorithm_options.pf
             --pfScale=$algorithm_options.pfScale
-
         #end if
-        #if $algorithm_options.measelect.mea == "yes":
+        #if $algorithm_options.measelect.mea == "yes"
             --MEA=$algorithm_options.measelect.meavalue
             --pfScale=$algorithm_options.pfScale
         #end if
 
         $algorithm_options.mis
-        #if $algorithm_options.stochBT_en <> 1
+        #if $algorithm_options.stochBT_en != 1
             --stochBT_en=$algorithm_options.stochBT_en
         #end if
-        $algorithm_options.circular
-        #if $algorithm_options.bppmThreshold <> 1e-6
+        $algorithm_options.circ
+        #if $algorithm_options.bppmThreshold != 1e-6
             --bppmThreshold=$algorithm_options.bppmThreshold
         #end if
         $algorithm_options.gquad
-        $algorithm_options.sci		
-        $model_options.notetra
-        $model_options.nolp
-        $model_options.nogu
-        $model_options.noclosinggu
-        #if $model_options.cfactor <> 1.0
+        $algorithm_options.sci
+        $model_options.noTetra
+        $model_options.noLP
+        $model_options.noGU
+        $model_options.noClosingGU
+        #if $model_options.cfactor != 1.0
             --cfactor=$model_options.cfactor
         #end if
-        #if $model_options.nfactor <> 1.0
+        #if $model_options.nfactor != 1.0
             --nfactor=$model_options.nfactor
         #end if
         $model_options.endgaps
-        $model_options.ribosum
+        $model_options.ribosum_scoring
         #if $model_options.nsp
             --nsp='$model_options.nsp'
         #end if
-        #if $model_options.betaScale <> 1.0
+        #if $model_options.betaScale != 1.0
             --betaScale=$model_options.betaScale
         #end if
-        && tar -cf '$imagesFile' *.ps		
+
+        < ./input.${input.ext} > '$tabularFile'
+
+        && tar -cf '$imagesFile' *.ps
 ]]>
     </command>
     <inputs>
         <param format="clustal,fasta,stockholm,maf" name="input" type="data" label="Clustal/AlignmentFasta/Stockholm/MAF file"/>
-
         <section name="algorithm_options" title="Algorithm Options">
-            <param name="pf" type="select" label="Calculate partition function" help="Calculate the partition function and base pairing probability matrix in addition to the mfe structure. Default is calculation of mfe structure only." argument="-p">
+            <param argument="-p" name="pf" type="select" label="Calculate partition function" help="Calculate the partition function and base pairing probability matrix in addition to the mfe structure.">
                 <option value="-1" selected="true">None</option>
                 <option value="0">0: Deactivates the calculation of the pair probabilities, saving about 50% in runtime</option>
-                <option value="1" >1: Calculate the partition function and base pairing probability matrix</option>				
+                <option value="1">1: Calculate the partition function and base pairing probability matrix</option>
             </param>
-
             <conditional name="measelect">
-                <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA">
+                <param argument="--MEA" name="mea" type="select" label="Calculate Maximum Expected accuracy">
                     <option value="no">No</option>
                     <option value="yes">Yes</option>
                 </param>
                 <when value="yes">
-                    <param name="meavalue" type="float" value="1.0" label="Gamma Value" help="Calculate an MEA (maximum expected accuracy) structure. The parameter gamma tunes the importance of correctly predicted pairs versus unpaired bases. Thus, for small values of gamma the MEA structure will contain only pairs with very high probability. where the expected accuracy is computed from the pair probabilities: each base pair (i,j) gets a score 2*gamma*p_ij and the score of an unpaired base is given by the probability of not forming a pair."/>
+                    <param name="meavalue" type="float" value="1.0" label="Gamma Value" help="Tune the importance of correctly predicted pairs versus unpaired bases."/>
                 </when>
+                <when value="no"/>
             </conditional>
-
-            <param argument="--mis" type="boolean" checked="false" truevalue="--mis" falsevalue="" label="Most Informative Sequence" help="Output 'most informative sequence' instead of simple consensu"/>							
-            <param name="stochBT_en" type="integer" value="1" label="Number of random structures." help="Compute a certain number of random structures with a probability dependend on the partition function. Print out the energies and probabilities of the backtraced structures. " argument="--stochBT_en"/>	        
-            <param name="pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences." argument="--pfScale"/>						
-            <param name="circular" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA structure" help="--circ"/>
-            <param name="bppmThreshold" type="float" value="1e-6" label="Threshold for base pair probabilities" help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." argument="--bppmThreshold"/>
-            <param name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="G Quadruplex formation" help="Take into account G Quadruplex formation (-g)"/>
-            <param name="sci" type="boolean" truevalue="--sci" falsevalue="" checked="false" label="Structure conservation index" 
-                help="Compute the structure conservation index (SCI) for the MFE consensus structure of the alignment" argument="--sci"/>
-        </section>    
+            <param argument="--mis" type="boolean" checked="false" truevalue="--mis" falsevalue="" label="Most Informative Sequence" help="Output 'most informative sequence' instead of simple consensus"/>
+            <param argument="--stochBT_en" type="integer" value="1" label="Number of random structures" help="Compute a certain number of random structures with a probability dependent on the partition function."/>
+            <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy."/>
+            <param argument="--circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA structure"/>
+            <param argument="--bppmThreshold" type="float" value="1e-6" label="Threshold for base pair probabilities"/>
+            <param argument="--gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="G Quadruplex formation" help="Take into account G Quadruplex formation"/>
+            <param argument="--sci" type="boolean" truevalue="--sci" falsevalue="" checked="false" label="Structure conservation index" help="Compute the structure conservation index (SCI) for the MFE consensus structure of the alignment"/>
+        </section>
         <section name="general_options" title="General Options">
-            <param name="verbose" type="boolean" truevalue="--v" falsevalue="" checked="false" label=" Be verbose" argument="--v"/>
-            <param name="color" type="boolean" truevalue="--color" falsevalue="" checked="false" label="Colored secondary structure image" 
-                help="Produce a colored version of the consensus strcture plot" argument="--color"/>
-            <param name="alignment" type="boolean" truevalue="--aln" falsevalue="" checked="false" 
-                label="Colored and annotated alignment image" 
-                help="Produce a colored and structure annotated alignment" 
-                argument="--aln"/>
-            <param name="layout_type" type="select" label="Layout algorithm" argument="--layout-type">
+            <param argument="--verbose" type="boolean" truevalue="--v" falsevalue="" checked="false" label="Be verbose"/>
+            <param argument="--color" type="boolean" truevalue="--color" falsevalue="" checked="false" label="Colored secondary structure image" help="Produce a colored version of the consensus structure plot"/>
+            <param argument="--aln" type="boolean" truevalue="--aln" falsevalue="" checked="false" label="Colored and annotated alignment image" help="Produce a colored and structure annotated alignment"/>
+            <param argument="--layout-type" type="select" label="Layout algorithm">
                 <option value="1" selected="true">Default: Naview layout</option>
                 <option value="0">Simple radial layout</option>
             </param>
-            <param name="noPS" type="boolean" truevalue="" falsevalue="--noPS" checked="true" label="Produce postscript output" help="" argument="--noPS"/>
+            <param argument="--noPS" type="boolean" truevalue="" falsevalue="--noPS" checked="true" label="Produce postscript output"/>
         </section>
-        <section name="IDs" title="Naming Conventions">		
-                <param name="continuous_ids" 
-                    type="boolean" truevalue="--continuous-ids" falsevalue="" checked="false" 
-                    label="Continuous alignment ID numbering" 
-                    help="Use continuous alignment ID numbering when no alignment ID can be retrieved from input data." 
-                    argument="--continuous-ids"/>
-                <param name="auto_id" 
-                    type="boolean" truevalue="--auto-id" falsevalue="" checked="false" 
-                    label="Automatically generate an ID for each alignment." 
-                    help="If this flag is active, RNAalifold ignores any IDs retrieved from the input and automatically generates an ID for each alignment." 
-                    argument="--auto-id"/>
-                <param name="id_prefix" 
-                    type="text" value="alignment" 
-                    label="Prefix for automatically generated IDs (as used in output file names)" 
-                    help="If this parameter is set, each alignment will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated alignment), etc. where xxxx is the alignment number beginning with the second alignment in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input alignment." 
-                    argument="--id-prefix"/>
-                <param name="id_digits" 
-                    type="integer" value="4" min="1" max="18" 
-                    label="The number of digits of the counter in automatically generated alignment IDs" 
-                    help="When alignments IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." 
-                    argument="--id-digits"/>
-                <param name="id_start" 
-                    type="integer" value="1" min="0" 
-                    label="First number in automatically generated alignment IDs" 
-                    help="When alignment IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous alignment IDs, i.e. it activates the −−continuous−ids flag.." 
-                    argument="--id-start"/>
+        <section name="IDs" title="Naming Conventions">
+            <param argument="--continuous-ids" type="boolean" truevalue="--continuous-ids" falsevalue="" checked="false" label="Continuous alignment ID numbering"/>
+            <param argument="--auto-id" type="boolean" truevalue="--auto-id" falsevalue="" checked="false" label="Automatically generate an ID for each alignment"/>
+            <param argument="--id-prefix" type="text" value="alignment" label="Prefix for automatically generated IDs"/>
+            <param argument="--id-digits" type="integer" value="4" min="1" max="18" label="Number of digits in automatically generated alignment IDs"/>
+            <param argument="--id-start" type="integer" value="1" min="0" label="First number in automatically generated alignment IDs"/>
         </section>
         <section name="constraints" title="Structure constraints">
-                <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
-                <conditional name="constraintLocation">
-                    <param name="constraintSelector" type="select" label="Constraints" argument="--constraint">
-                        <!--	<option value="fromInput">The constraints are included in the input file</option> -->
-                        <option value="fromFile">The constraints are in a seperate file</option>
-                        <option value="none" selected="true">Don't use constraints</option>
-                    </param>
-                <!--	<when value="fromInput"></when> -->
-                    <when value="none"></when>
-                    <when value="fromFile">
-                        <param name="constraintsFile" type="data" format="txt" label="Constraints file"/>
-                        <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" 
-                            label="Use constraints for all alignment records" 
-                            help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAalifold processes all sequence alignments in the input and applies the same provided constraints to each of them." 
-                            argument="--batch"/>
-                        <param name="ss_cons" type="boolean" checked="false" truevalue="--SS_cons" falsevalue="" 
-                            label="Use consensus structures from Stockholm file (#=GF SS_cons) as constraint" 
-                            help="Stockholm formatted alignment files have the possibility to store a secondary structure string in one of if ('#=GC') column annotation meta tags. The corresponding tag name is usually 'SS_cons', a consensus secondary structure. Activating this flag allows one to use this consensus secondary structure from the input file as structure constraint. Note: Activating this flag implies −−constraint." 
-                            argument="--SS_cons"/>	
-                    </when>
-                </conditional>
-                <conditional name="shapeOption">
-                        <param name="shapeSelector" type="select" label="Shape reactivity data">
-                            <option value="isUsed">Use shape reactivity data</option>
-                            <option value="notUsed" selected="true">Don't use shape reactivity data</option>
-                        </param>
-                        <when value ="isUsed">
-                            <repeat name="shape_files" title="Shape File" default="0">
-                                <param type="data" name="shape" format="txt" label="Shape file" argument="--shape"/>
-                            </repeat>
-                                <param name="m" type="float" value="1.8" label="Slope m" />
-                                <param name="b" type="float" value="-0.6" label="Intercept b" help="Currently, the only data conversion method available is that of to Deigan et al 2009. This method is the default. The slope 'm' and the intercept 'b' can be set to a non−default value if necessary. Otherwise m=1.8 and b=−0.6 as stated in the paper mentioned before."/>
-                        </when>
-                        <when value="notUsed">
-                        </when>
-                </conditional>
+            <param argument="--maxBPspan" type="integer" value="-1" label="Set the maximum base pair span"/>
+            <conditional name="constraintLocation">
+                <param argument="--constraint" name="constraintSelector" type="select" label="Constraints">
+                    <option value="fromFile">The constraints are in a separate file</option>
+                    <option value="none" selected="true">Don't use constraints</option>
+                </param>
+                <when value="none"/>
+                <when value="fromFile">
+                    <param name="constraintsFile" type="data" format="txt" label="Constraints file"/>
+                    <param argument="--batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" label="Use constraints for all alignment records"/>
+                    <param argument="--SS_cons" type="boolean" checked="false" truevalue="--SS_cons" falsevalue="" label="Use consensus structures from Stockholm file as constraint"/>
+                </when>
+            </conditional>
+            <conditional name="shapeOption">
+                <param name="shapeSelector" type="select" label="Shape reactivity data">
+                    <option value="isUsed">Use shape reactivity data</option>
+                    <option value="notUsed" selected="true">Don't use shape reactivity data</option>
+                </param>
+                <when value="isUsed">
+                    <repeat name="shape_files" title="Shape File" default="0">
+                        <param argument="--shape" type="data" format="txt" label="Shape file"/>
+                    </repeat>
+                    <param name="m" type="float" value="1.8" label="Slope m"/>
+                    <param name="b" type="float" value="-0.6" label="Intercept b"/>
+                </when>
+                <when value="notUsed"/>
+            </conditional>
         </section>
         <section name="model_options" title="Model Options" expanded="true">
-            <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
+            <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
             <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
                 <option value="0">0: ignore dangling ends</option>
-                <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+                <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             </param>
-            <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-            <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-            <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>            
-            <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>              
-            <param name="cfactor" type="float" value="1.0" label="Weight of the covariance term" help="--cfactor"/>
-            <param name="nfactor" type="float" value="1.0" label="Penalty for non-compatible sequences in the covariance term" help="--nfactor"/>
-            <param name="endgaps" type="boolean" truevalue="--endgaps" falsevalue="" checked="false" label="Score pairs with endgaps same as gap-gap pairs" help="--endgaps"/>
-            <param name="ribosum" type="boolean" truevalue="--ribosum_scoring" falsevalue="" checked="false" label="Use ribosum scoring matrix" help="--ribosum_scoring"/>
-            <param name="nsp" type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs." help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy."   argument="--nsp"/>
-            <param name="betaScale" type="float" value="1.0" label="Scaling of Boltzman factors" 
-                help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." 
-                argument="--betaScale"/>
+            <param argument="--noLP" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+            <param argument="--noGU" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+            <param argument="--noClosingGU" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+            <param argument="--noTetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+            <param argument="--cfactor" type="float" value="1.0" label="Weight of the covariance term"/>
+            <param argument="--nfactor" type="float" value="1.0" label="Penalty for non-compatible sequences in the covariance term"/>
+            <param argument="--endgaps" type="boolean" truevalue="--endgaps" falsevalue="" checked="false" label="Score pairs with endgaps same as gap-gap pairs"/>
+            <param argument="--ribosum_scoring" type="boolean" truevalue="--ribosum_scoring" falsevalue="" checked="false" label="Use ribosum scoring matrix"/>
+            <param argument="--nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs" help="Comma-separated list of additionally allowed pairs."/>
+            <param argument="--betaScale" type="float" value="1.0" label="Scaling of Boltzmann factors"/>
         </section>
     </inputs>
     <outputs>
-        <data format="txt" name="tabularFile"/>
-        <data format="tar" name="imagesFile"/>
+        <data format="txt" name="tabularFile" label="${tool.name} on ${on_string}"/>
+        <data format="tar" name="imagesFile" label="${tool.name} images on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnaalifold_input1.clustal"/>
-            <output name="output" file="rnaalifold_result1.txt"/>
+            <output name="tabularFile" file="rnaalifold_result1.txt"/>
         </test>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnaalifold_input1.fa"/>
-            <output name="output" file="rnaalifold_resultfa.txt"/>
+            <output name="tabularFile" file="rnaalifold_resultfa.txt"/>
         </test>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnaalifold_input1.stk"/>
-            <output name="output" file="rnaalifold_resultstk.txt"/>
-        </test>       
-        <test>
+            <output name="tabularFile" file="rnaalifold_resultstk.txt"/>
+        </test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnaalifold_input1.clustal"/>
-            <param name="mea" value="yes"/>
-            <output name="output" file="rnaalifold_result_MEA.txt"/>
+            <section name="algorithm_options">
+                <conditional name="measelect">
+                    <param name="mea" value="yes"/>
+                </conditional>
+            </section>
+            <output name="tabularFile" file="rnaalifold_result_MEA.txt"/>
         </test>
-        
-
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAalifold**
 
+Reads aligned RNA sequences from a file and calculates their minimum free energy (mfe) structure, partition function (pf) and base pairing probability matrix. Currently supported alignment formats are ClustalW, FASTA alignment, Stockholm, and MAF.
+
 -----
 
 **Input format**
 
-RNAalifold requires one input file
+RNAalifold requires one input file:
+
 - Clustal/AlignmentFasta/Stockholm/MAF file
 
-------
+-----
 
 **Outputs**
 
-- energy of the consensus structures in the clustal file
-- several possible postscript images bundled together in a tar file
-
-
+- Energy of the consensus structures in the alignment
+- Several possible postscript images bundled together in a tar file
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnacofold.xml b/tools/rna_tools/vienna_rna/rnacofold.xml
index ee5de99f2c..c74fb400b0 100644
--- a/tools/rna_tools/vienna_rna/rnacofold.xml
+++ b/tools/rna_tools/vienna_rna/rnacofold.xml
@@ -1,34 +1,34 @@
-<tool id="viennarna_rnacofold" name="@EXECUTABLE@" version="@VERSION@.0">
+<tool id="viennarna_rnacofold" name="RNAcofold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Calculate secondary structures of two RNAs with dimerization</description>
     <macros>
         <token name="@EXECUTABLE@">RNAcofold</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
-        RNAcofold  < '$input' > '$tabularFile'
-        -T$model_options.temperature -d$model_options.dangling        
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
+        RNAcofold < '$input' > '$tabularFile'
+        -T$model_options.temperature -d$model_options.dangling
         $general_options.noPS
-        $general_options.noconversion        
+        $general_options.noconversion
         $IDs.auto_id
-        #if str($IDs.id_prefix) <> "alignment"
+        #if str($IDs.id_prefix) != "alignment"
             --id-prefix='$IDs.id_prefix'
         #end if
-        #if $IDs.id_digits <> 4
+        #if $IDs.id_digits != 4
             --id-digits=$IDs.id_digits
         #end if
-        #if $IDs.id_start <> 1
+        #if $IDs.id_start != 1
             --id-start=$IDs.id_start
-        #end if        
+        #end if
         #if str($constraints.constraintLocation.constraintSelector) == "fromFile"
             --constraint='$constraints.constraintLocation.constraintsFile'
             $constraints.constraintLocation.canonicalBPonly
-            $constraints.constraintLocation.enforceConstraint                
+            $constraints.constraintLocation.enforceConstraint
         #end if
-        #if str($constraints.constraintLocation.constraintSelector) == "inFile" 
+        #if str($constraints.constraintLocation.constraintSelector) == "inFile"
             -C
         #end if
         $algorithm_options.allpf
@@ -37,16 +37,16 @@
                 --concfile='$i.concfile'
             #end for
         #end if
-        #if $algorithm_options.pf <> "-1"
+        #if $algorithm_options.pf != "-1"
             --partfunc=$algorithm_options.pf
         #end if
-        #if $algorithm_options.pfScale <> 1.07
+        #if $algorithm_options.pfScale != 1.07
             --pfScale=$algorithm_options.pfScale
         #end if
-        #if $algorithm_options.bppmThreshold <> 1e-5
+        #if $algorithm_options.bppmThreshold != 1e-5
             --bppmThreshold=$algorithm_options.bppmThreshold
         #end if
-        $algorithm_options.gquad		
+        $algorithm_options.gquad
         $model_options.notetra
         $model_options.nolp
         $model_options.nogu
@@ -54,134 +54,105 @@
         #if $model_options.nsp
             --nsp='$model_options.nsp'
         #end if
-        #if $model_options.betaScale <> 1.0
+        #if $model_options.betaScale != 1.0
             --betaScale=$model_options.betaScale
         #end if
-        
 ]]>
     </command>
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
+        <param argument="--input" format="fasta" name="input" type="data" label="FASTA file"/>
         <section name="general_options" title="General Options">
-            <param name="noPS" type="boolean" truevalue="" falsevalue="--noPS" checked="true" label="Produce postscript output" help="" argument="--noPS"/>
-            <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" argument="--noconv" help="Avoids confusion with DNA sequences"/>
+            <param argument="--noPS" name="noPS" type="boolean" truevalue="" falsevalue="--noPS" checked="true" label="Produce postscript output"/>
+            <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)" help="Avoids confusion with DNA sequences"/>
         </section>
-        <section name="IDs" title="Naming Conventions">		
-                <param name="auto_id" 
-                    type="boolean" truevalue="--auto-id" falsevalue="" checked="false" 
-                    label="Automatically generate an ID for each alignment." 
-                    help="If this flag is active, RNAalifold ignores any IDs retrieved from the input and automatically generates an ID for each alignment." 
-                    argument="--auto-id"/>
-                <param name="id_prefix" 
-                    type="text" value="alignment" 
-                    label="Prefix for automatically generated IDs (as used in output file names)" 
-                    help="If this parameter is set, each alignment will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated alignment), etc. where xxxx is the alignment number beginning with the second alignment in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input alignment." 
-                    argument="--id-prefix"/>
-                <param name="id_digits" 
-                    type="integer" value="4" min="1" max="18" 
-                    label="The number of digits of the counter in automatically generated alignment IDs" 
-                    help="When alignments IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." 
-                    argument="--id-digits"/>
-                <param name="id_start" 
-                    type="integer" value="1" min="0" 
-                    label="First number in automatically generated alignment IDs" 
-                    help="When alignment IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous alignment IDs, i.e. it activates the −−continuous−ids flag.." 
-                    argument="--id-start"/>
+        <section name="IDs" title="Naming Conventions">
+            <param argument="--auto-id" name="auto_id" type="boolean" truevalue="--auto-id" falsevalue="" checked="false" label="Automatically generate an ID for each sequence." help="If active, RNAcofold ignores any IDs retrieved from the input and automatically generates an ID for each sequence."/>
+            <param argument="--id-prefix" name="id_prefix" type="text" value="alignment" label="Prefix for automatically generated IDs (as used in output file names)"/>
+            <param argument="--id-digits" name="id_digits" type="integer" value="4" min="1" max="18" label="Number of digits in automatically generated sequence IDs"/>
+            <param argument="--id-start" name="id_start" type="integer" value="1" min="0" label="First number in automatically generated sequence IDs"/>
         </section>
         <section name="model_options" title="Model Options" expanded="true">
-            <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="(-T)"/>
-            <param name="dangling" type="select" label="How to treat dangling end energies" help="(-d)">
+            <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+            <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
                 <option value="0">0: ignore dangling ends</option>
-                <option value="1">1: only unpaired bases can participate in at most one dangling end, this is the default for mfe folding but unsupported for the partition function folding</option>
-                <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
-                <option value="3">3: mfe folding will allow coaxial stacking of adjacent helices in multi−loops.</option>
+                <option value="1">1: only unpaired bases can participate in at most one dangling end</option>
+                <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
+                <option value="3">3: allow coaxial stacking of adjacent helices in multi-loops</option>
             </param>
-            <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-            <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-            <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-            <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-            <param name="nsp" type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs."
-               help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." 
-               argument="--nsp"/>
-            <param name="betaScale" type="float" value="1.0" label="Scaling of Boltzman factors" 
-                help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." 
-                argument="--betaScale"/>
+            <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+            <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+            <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+            <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+            <param argument="--nsp" name="nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs, e.g. GA."/>
+            <param argument="--betaScale" name="betaScale" type="float" value="1.0" label="Scaling of Boltzmann factors"/>
         </section>
         <section name="constraints" title="Structure constraints">
-                <conditional name="constraintLocation">
-                    <param name="constraintSelector" type="select" label="Constraints">
-                      <!--	<option value="fromInput">The constraints are included in the input file</option> -->
-                        <option value="fromFile">The constraints are in a seperate file</option>
-                        <option value="inFile">The constraints are in the fasta input file</option>
-                        <option value="none" selected="true">Don't use constraints</option>
-                    </param>
-                    <!-- <when value="fromInput"></when> -->
-                    <when value="none"></when>
-                    <when value="inFile"></when>
-                    <when value="fromFile">
-                        <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/>
-                        <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint" />
-                        <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint" />
-                    </when>
-                </conditional>				
+            <conditional name="constraintLocation">
+                <param name="constraintSelector" type="select" label="Constraints">
+                    <option value="fromFile">The constraints are in a separate file</option>
+                    <option value="inFile">The constraints are in the FASTA input file</option>
+                    <option value="none" selected="true">Don't use constraints</option>
+                </param>
+                <when value="none"/>
+                <when value="inFile"/>
+                <when value="fromFile">
+                    <param argument="--constraint" name="constraintsFile" type="data" format="txt" label="Constraints file"/>
+                    <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from the structure constraint"/>
+                    <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pairs given by round brackets () in structure constraint"/>
+                </when>
+            </conditional>
         </section>
         <section name="algorithm_options" title="Algorithm Options">
-            <param name="pf" type="select" label="Calculate partition function" help="Calculate the partition function and base pairing probability matrix in addition to the mfe structure. Default is calculation of mfe structure only." argument="-p">
+            <param argument="-p" name="pf" type="select" label="Calculate partition function" help="Calculate the partition function and base pairing probability matrix in addition to the mfe structure.">
                 <option value="-1" selected="true">None</option>
-                <option value="0">0: Deactivates the calculation of the pair probabilities, saving about 50% in runtime</option>
-                <option value="1" >1: Calculate the partition function and base pairing probability matrix</option>				
+                <option value="0">0: Deactivates calculation of pair probabilities (saves ~50% runtime)</option>
+                <option value="1">1: Calculate the partition function and base pairing probability matrix</option>
             </param>
-            <param name="allpf" type="boolean" checked="false" truevalue="--all_pf" falsevalue="" label="Calculate homo-dimers as well as A and B monomers" help="--all_pf"/>
-            <param argument="-c" type="boolean" checked="false" truevalue="-c" falsevalue="" label="Concentrations" help="In addition to everything listed under the -a option, read in initial monomer concentrations and compute the expected equilibrium concentrations of the 5 possible species (AB, AA, BB, A, B)."/>
-            <repeat name="concfiles" title="A file with initial concentrations for the two sequences" default="0" max="1" help="The table consits of arbitrary many lines with just two numbers (the concentration of sequence A and B). This option will automatically toggle the −c (and thus -a and --all_pf) options">
+            <param argument="--all_pf" name="allpf" type="boolean" checked="false" truevalue="--all_pf" falsevalue="" label="Calculate homo-dimers as well as A and B monomers"/>
+            <param argument="-c" type="boolean" checked="false" truevalue="-c" falsevalue="" label="Concentrations" help="Read initial monomer concentrations and compute expected equilibrium concentrations of the 5 possible species (AB, AA, BB, A, B)."/>
+            <repeat name="concfiles" title="Concentrations file" default="0" max="1" help="Table of initial concentrations for the two sequences. This option toggles -c and --all_pf automatically.">
                 <param type="data" name="concfile" format="txt" label="Concentrations file"/>
-            </repeat>			
-            <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
-            <param argument="--bppmThreshold" type="float" value="1e-5" label="Threshold for base pair probabilities" help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data."/>
-            <param argument="--gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="G Quadruplex formation" help="take into account G Quadruplex formation"/>
-        </section>      
+            </repeat>
+            <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="Use scale*mfe as an estimate for the ensemble free energy."/>
+            <param argument="--bppmThreshold" type="float" value="1e-5" label="Threshold for base pair probabilities"/>
+            <param argument="--gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="Take G Quadruplex formation into account"/>
+        </section>
     </inputs>
     <outputs>
-        <data format="txt" name="tabularFile"/>
-        <collection name="sequence_outputs" type="list" label="rna_eps outputs">
-            <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps" />
+        <data format="txt" name="tabularFile" label="${tool.name} on ${on_string}"/>
+        <collection name="sequence_outputs" type="list" label="${tool.name} structure plots on ${on_string}">
+            <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps"/>
         </collection>
-        <collection name="matrix_outputs" type="list" label="rna_eps outputs">
-            <filter>pf is True</filter>
+        <collection name="matrix_outputs" type="list" label="${tool.name} dot plots on ${on_string}">
+            <filter>algorithm_options['pf'] != "-1"</filter>
             <discover_datasets pattern="(?P&lt;designation&gt;.+)_dp\.ps" ext="rna_eps" visible="true"/>
         </collection>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnacofold_input1.fas"/>
-            <output name="out_file" file="rnacofold_result1.txt"/>
+            <output name="tabularFile" file="rnacofold_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAcofold**
 
+Calculates minimum free energy secondary structures of two RNA sequences and their dimers.
 
 -----
 
 **Input format**
 
-RNAcofold requires one input file:
-
-- Fasta file
-
-Two different RNA sequences can be specified concatenated with the '&' character. The folding of the two sequences with each other will be calculated.
+RNAcofold requires one FASTA file. Two different RNA sequences can be specified concatenated with the '&' character. The folding of the two sequences with each other will be calculated.
 
-
-------
+-----
 
 **Outputs**
 
 - Energies of the RNA sequences and the dimers
 - Structure images
-- Dot Plot Matrix images (if --partfunc is used)
-
+- Dot plot matrix images (if partition function is calculated)
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnadistance.xml b/tools/rna_tools/vienna_rna/rnadistance.xml
index 2710879107..beefba47a8 100644
--- a/tools/rna_tools/vienna_rna/rnadistance.xml
+++ b/tools/rna_tools/vienna_rna/rnadistance.xml
@@ -1,85 +1,77 @@
-<tool id="viennarna_rnadistance" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>Calculate distance between secondary structures of two RNAs</description>
+<tool id="viennarna_rnadistance" name="RNAdistance" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Calculate distances between secondary structures of RNAs</description>
     <macros>
         <token name="@EXECUTABLE@">RNAdistance</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
         RNAdistance < '$input' > '$outfile'
         --distance=#echo ''.join(str($distance).split(','))#
         --compare=$compare
         $shapiro
         $backtrack
-        #if $backtrack and str($compare)=="m"
+        #if $backtrack and str($compare) == "m"
             && cat backtrack.file >> '$outfile'
         #end if
 ]]>
     </command>
     <inputs>
-        <param name="input" type="data" format="txt" label="Primary and secondary stuctures file"/>
-        <param name="distance" type="select" multiple="true" display="checkboxes" label="Representation to calculate the distance / alignment option">
-                <option value="f" selected="true">full/tree</option>
-                <option value="F">full/string</option>
-                <option value="h">hit/tree</option>
-                <option value="H">hit/string</option>
-                <option value="w">weighted coarse/tree</option>
-                <option value="W">weighted coarse/string</option>
-                <option value="c">coarse/tree</option>
-                <option value="C">coarse/string</option>
-                <validator type="no_options" message="Please select at least one type."/>
+        <param name="input" type="data" format="txt" label="Structures file (sequence + dot-bracket notation)"/>
+        <param argument="--distance" name="distance" type="select" multiple="true" label="Representation to calculate the distance">
+            <option value="f" selected="true">full/tree</option>
+            <option value="F">full/string</option>
+            <option value="h">hit/tree</option>
+            <option value="H">hit/string</option>
+            <option value="w">weighted coarse/tree</option>
+            <option value="W">weighted coarse/string</option>
+            <option value="c">coarse/tree</option>
+            <option value="C">coarse/string</option>
+            <validator type="no_options" message="Please select at least one type."/>
         </param>
-        <param name="compare" type="select" label="Comparison Option" help="-d">
-            <option value="p" selected="True">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
+        <param argument="--compare" name="compare" type="select" label="Comparison option">
+            <option value="p" selected="true">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
             <option value="m">m: matrix (each with each, output in matrix form)</option>
-            <option value="f" >f: first (1st with 2nd, 1st with 3rd, ...)</option>
+            <option value="f">f: first (1st with 2nd, 1st with 3rd, ...)</option>
             <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option>
         </param>
-        <param argument="--shapiro" type="boolean" checked="false" truevalue="--shapiro" falsevalue="" label="Use cost matrix by Bruce Shapiro" help="--shapiro"/>
-        <param argument="--backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment" help="--backtrack"/>
+        <param argument="--shapiro" type="boolean" checked="false" truevalue="--shapiro" falsevalue="" label="Use cost matrix by Bruce Shapiro"/>
+        <param argument="--backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment"/>
     </inputs>
     <outputs>
-        <data format="txt" name="outfile"/>
+        <data format="txt" name="outfile" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnadistance_input1.dbn"/>
             <output name="outfile" file="rnadistance_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAdistance**
 
+Calculates distances between RNA secondary structures using various tree or string representations.
 
 -----
 
 **Input format**
 
-RNAdistance requires one input file with the following structure:
-1st line: can be a comment line like in Fasta, begins with '>'
-2nd line: sequence
-3rd line: first secondary structure in dot-bracket notation
-4th line: second secondary structure in dot-bracket notation
-...
-nth line: another sequence
-...
+RNAdistance requires one input file. Each entry consists of:
 
-Several different RNA secondary structures can be specified. The input has a Fasta-like structure but with secondary structure information.
+- Optional comment line starting with '>'
+- RNA sequence
+- One or more secondary structures in dot-bracket notation
 
-
-------
+-----
 
 **Outputs**
 
-* distance of the structures
-* with the backtrack options it is possible to get alignment ouput
-
-
+- Distance between the structures
+- With `--backtrack`: alignment output appended
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaduplex.xml b/tools/rna_tools/vienna_rna/rnaduplex.xml
index 71fb1bb1fa..0c4eff34db 100644
--- a/tools/rna_tools/vienna_rna/rnaduplex.xml
+++ b/tools/rna_tools/vienna_rna/rnaduplex.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rnaduplex" name="@EXECUTABLE@" version="@VERSION@.0">
+<tool id="viennarna_rnaduplex" name="RNAduplex" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Compute the structure upon hybridization of two RNA strands</description>
     <macros>
         <token name="@EXECUTABLE@">RNAduplex</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
         RNAduplex < '$input' > '$tabularFile'
         -T$temperature -d$dangling --deltaEnergy=$denergy
         #if $varExists('$advancedOptions.noconversion')
@@ -24,62 +24,58 @@
 ]]>
     </command>
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param format="fasta" name="input" type="data" label="FASTA file"/>
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="0">0: ignore dangling ends</option>
             <option value="1">1: unpaired bases participate in one dangling end only</option>
-            <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+            <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param argument="--denergy" type="float" value="0.0" label="delta energy range [kcal/mol] for suboptimal structures" help=""/>
-        <param argument="--sorted" type="boolean" truevalue="--sorted" falsevalue="" checked="false" label="Sort by energy" help=""/>
+        <param argument="--deltaEnergy" name="denergy" type="float" value="0.0" label="Energy range for suboptimal structures [kcal/mol]"/>
+        <param argument="--sorted" type="boolean" truevalue="--sorted" falsevalue="" checked="false" label="Sort output by energy"/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param argument="--noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences"/>
-                <param argument="--noLP" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help=""/>
-                <param argument="--noGU" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"  help="Allow pairing of G and U at the ends of helices."/>
-                <param argument="--noClosingGU" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices."/>
-                <param argument="--noTetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing."/>
-                <param argument="--nsp" type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs."
-                   help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy."/>
-            </when>
-            <when value="basic">
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
+                <param argument="--noLP" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs."/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="tabularFile"/>
+        <data format="txt" name="tabularFile" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnaduplex_input1.fa"/>
-            <output name="out_file" file="rnaduplex_result1.txt"/>
+            <output name="tabularFile" file="rnaduplex_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAduplex**
-RNA duplex reads two RNA sequences and computes optimal and suboptimal secondary structures for their hybridization. The calculation is simplified by allowing only inter−molecular base pairs, for the general case use RNAcofold. The computed optimal and suboptimal structure are written to stdout, one structure per line. Suboptimal structures are computed with energy in a certain range of the optimum (kcal/mol). Default is calculation of mfe structure only.
+
+Reads two RNA sequences and computes optimal and suboptimal secondary structures for their hybridization. The calculation is simplified by allowing only inter-molecular base pairs; for the general case use RNAcofold. Suboptimal structures are computed within an energy range of the optimum (kcal/mol).
 
 -----
 
 **Input format**
 
-RNAduplex requires one input file in Fasta format. The secondary strucures will be calculated pairwise: 1st sequence with 2nd sequence, 3rd sequence with 4th sequence, etc.
+RNAduplex requires one FASTA file. Structures are calculated pairwise: 1st sequence with 2nd, 3rd with 4th, etc.
 
-------
+-----
 
 **Outputs**
 
-Each line consist of: The structure in dot bracket format with a "&" separating the two strands. The range of the structure in the two sequences in the format "from,to : from,to"; the energy of duplex structure in kcal/mol. The format is especially useful for computing the hybrid structure between a small probe sequence and a long target sequence.
-
-
+Each line: structure in dot-bracket format with '&' separating the two strands, the range in both sequences as "from,to : from,to", and the energy of the duplex structure in kcal/mol.
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaeval.xml b/tools/rna_tools/vienna_rna/rnaeval.xml
index 5a278916b4..f373492ac3 100644
--- a/tools/rna_tools/vienna_rna/rnaeval.xml
+++ b/tools/rna_tools/vienna_rna/rnaeval.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rnaeval" name="@EXECUTABLE@" version="@VERSION@.0">
+<tool id="viennarna_rnaeval" name="RNAeval" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Calculate energy of RNA sequences with given secondary structure</description>
     <macros>
         <token name="@EXECUTABLE@">RNAeval</token>
         <import>macros.xml</import>
     </macros>
-     <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
         RNAeval < '$input' > '$tabularFile'
         -T$temperature -d$dangling
         #if $varExists('$advancedOptions.noconversion')
@@ -25,7 +25,7 @@
                     --shapeMethod=$s
                 #else if str($advancedOptions.shapeOption.shapeMethod.methodSelector) == "Z"
                     #set $s="Zb"+str($advancedOptions.shapeOption.shapeMethod.b)
-                    --shapeMethod=$s					
+                    --shapeMethod=$s
                     #if str($advancedOptions.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C"
                         #set $c="C"+str($advancedOptions.shapeOption.shapeMethod.shapeConversion.c)
                         --shapeConversion=$c
@@ -49,36 +49,36 @@
     </command>
     <inputs>
         <param format="txt,dbn" name="input" type="data" label="Input file"/>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="0">0: ignore dangling ends</option>
             <option value="1">1: unpaired bases participate in one dangling end only</option>
-            <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+            <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Print out energy of each loop in the structure." help="--verbose"/>
-                <param name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="G-quadruplex formation prediction" help="--gquad"/>
-                <param name="circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA" help="--circ"/>
-                <param name="logml" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Logarithmic energy functions for multi-loops" help="--logML"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>                
+                <param argument="--verbose" name="verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Print out energy of each loop in the structure"/>
+                <param argument="--gquad" name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="G-quadruplex formation prediction"/>
+                <param argument="--circ" name="circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA"/>
+                <param argument="--logML" name="logml" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Logarithmic energy functions for multi-loops"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
                 <conditional name="shapeOption">
                     <param name="shapeSelector" type="select" label="Shape reactivity data">
                         <option value="isUsed">Use shape reactivity data</option>
                         <option value="notUsed" selected="true">Don't use shape reactivity data</option>
                     </param>
-                    <when value ="isUsed">
-                        <param type="data" name="shapeFile" format="txt" label="Shape file" argument="--shape"/>
+                    <when value="isUsed">
+                        <param argument="--shape" name="shapeFile" type="data" format="txt" label="Shape file"/>
                         <conditional name="shapeMethod">
-                            <param name="methodSelector" type="select" label="Shape reactivity data" argument="--shapeMethod">
+                            <param argument="--shapeMethod" name="methodSelector" type="select" label="Shape reactivity data conversion method">
                                 <option value="D" selected="true">D: Convert by using a linear equation according to Deigan et al 2009</option>
-                                <option value="Z">Z: Convert SHAPE reactivities to pseudo energies according to Zarringhalam et al 2012.</option>
+                                <option value="Z">Z: Convert SHAPE reactivities to pseudo energies according to Zarringhalam et al 2012</option>
                                 <option value="W">W: Apply a given vector of perturbation energies to unpaired nucleotides according to Washietl et al 2012</option>
                             </param>
                             <when value="D">
@@ -88,20 +88,18 @@
                             <when value="Z">
                                 <param name="b" type="float" value="-0.6" label="Intercept"/>
                                 <conditional name="shapeConversion">
-                                    <param name="conversionSelector" type="select" label="shape reactivity data">
+                                    <param name="conversionSelector" type="select" label="Shape reactivity conversion">
                                         <option value="M">M: Use linear mapping according to Zarringhalam et al</option>
-                                        <option value="C">C: Use a cutoff−approach to divide into paired and unpaired nucleotides</option>
-                                        <option value="S">S: Skip the normalizing step since the input data already represents probabilities for being unpaired rather than raw reactivity values</option>
+                                        <option value="C">C: Use a cutoff-approach to divide into paired and unpaired nucleotides</option>
+                                        <option value="S">S: Skip the normalizing step</option>
                                         <option value="L">L: Use a linear model to convert the reactivity into a probability for being unpaired</option>
                                         <option value="O" selected="true">O: Use a linear model to convert the log of the reactivity into a probability for being unpaired</option>
                                     </param>
-                                    <when value="M">
-                                    </when>
+                                    <when value="M"/>
                                     <when value="C">
                                         <param name="c" type="float" value="0.25" label="Cutoff"/>
                                     </when>
-                                    <when value="S">
-                                    </when>
+                                    <when value="S"/>
                                     <when value="L">
                                         <param name="s" type="float" value="0.68" label="Slope"/>
                                         <param name="i" type="float" value="0.2" label="Intercept"/>
@@ -112,47 +110,41 @@
                                     </when>
                                 </conditional>
                             </when>
-                            <when value="W">
-                            </when>
+                            <when value="W"/>
                         </conditional>
                     </when>
-                    <when value="notUsed">
-                    </when>
+                    <when value="notUsed"/>
                 </conditional>
             </when>
-            <when value="basic">
-            </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="tabularFile"/>
+        <data format="txt" name="tabularFile" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnaeval_input1.dbn"/>
-            <output name="out_file" file="rnaeval_result1.txt"/>
+            <output name="tabularFile" file="rnaeval_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAeval**
-RNAeval evaluates the free energy of an RNA molecule in fixed secondary structure. Sequences and structures are read alternately from stdin. The energy in Kcal/Mol is written to stdout.
+
+Evaluates the free energy of an RNA molecule in a fixed secondary structure. Sequences and structures are read alternately from stdin. The energy in kcal/mol is written to stdout.
 
 -----
 
 **Input format**
 
-RNAeval requires one input file in a format similar to the Fasta format. The secondary strucures should be added after the sequence in dot-bracket notation. Sequence and structure can be interupted by an '&' to calculate the co-folding of two RNA-strands.
-
+RNAeval requires one input file in a format similar to FASTA. The secondary structures should be added after the sequence in dot-bracket notation. Sequence and structure can be interrupted by an '&' to calculate the co-folding of two RNA strands.
 
-------
+-----
 
 **Outputs**
 
-First line: the sequence, second line: the structure with its corresponding energy
-
-
+- First line: the sequence; second line: the structure with its corresponding energy
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnafold.xml b/tools/rna_tools/vienna_rna/rnafold.xml
index 161e11c767..1e9915923b 100644
--- a/tools/rna_tools/vienna_rna/rnafold.xml
+++ b/tools/rna_tools/vienna_rna/rnafold.xml
@@ -1,15 +1,19 @@
-<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.4">
+<tool id="viennarna_rnafold" name="RNAfold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Calculate minimum free energy secondary structures and partition function of RNAs</description>
     <macros>
         <token name="@EXECUTABLE@">RNAfold</token>
         <import>macros.xml</import>
     </macros>
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
     <expand macro="requirements">
-	    <requirement type="package" version="1.65">biopython</requirement>
+        <requirement type="package" version="1.88">biopython</requirement>
     </expand>
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
+    <required_files>
+        <include path="rnafold_SHAPE.py"/>
+    </required_files>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive">
  <![CDATA[
     #if str($input_source.select_fasta) == "false"
         #if str($input_source.input_sequence).lstrip()[0] == ">"
@@ -115,7 +119,6 @@
     > '$dot_bracket_stdout'
 ]]>
     </command>
-
     <inputs>
         <conditional name="input_source">
             <param name="select_fasta" type="select" label="Input from FASTA file">
@@ -136,14 +139,12 @@
             <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" >
+        <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type">
             <option value="1" selected="true">Default: Naview layout</option>
             <option value="0">Simple radial layout</option>
         </param>
-
         <param name="mea" type="boolean" checked="false" falsevalue="" label="Calculate Maximum Expected accuracy" help="--MEA"/>
-        <param name="meagamma" type="float"  optional="true" label="MEA-Gamma Value"/>
-
+        <param name="meagamma" type="float" optional="true" label="MEA-Gamma Value"/>
         <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>
         <param name="pfscale" type="float" optional="true" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
         <section name="advancedOptions" title="Advanced options">
@@ -152,148 +153,102 @@
             <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
             <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
             <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-            <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>
-            <param name="gquad"
-                   type="boolean"
-                   truevalue="--gquad"
-                   falsevalue=""
-                   checked="false"
-                   label="Take G Quadruplex formation into account"
-                   argument="-g"/>
-            <param name="circular"
-                   type="boolean"
-                   truevalue="--circ"
-                   falsevalue=""
-                   checked="false"
-                   label="Model as circular RNA structure"
-                   argument="--circ"/>
-             <param name="bppmThreshold"
-                     type="float"
-                     value="1e-5"
-                     label="Threshold for base pair probabilities"
-                     help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data."
-                     argument="--bppmThreshold"/>
-             <param name="nsp"
-                   type="text"
-                   value=""
-                   label="Allow other pairs in addition to the usual AU,GC,and GU pairs."
-                   help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy."
-                   argument="--nsp"/>
-            <param name="betaScale"
-                    type="float"
-                    value="1.0"
-                    label="Scaling of Boltzman factors"
-                    help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types."
-                    argument="--betaScale"/>
+            <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)" help="Avoids confusion with DNA sequences (--noconv)"/>
+            <param name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="Take G Quadruplex formation into account" argument="-g"/>
+            <param name="circular" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Model as circular RNA structure" argument="--circ"/>
+            <param name="bppmThreshold" type="float" value="1e-5" label="Threshold for base pair probabilities" help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." argument="--bppmThreshold"/>
+            <param name="nsp" type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs." help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." argument="--nsp"/>
+            <param name="betaScale" type="float" value="1.0" label="Scaling of Boltzman factors" help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." argument="--betaScale"/>
         </section>
         <section name="constraints" title="Structure constraints">
-                <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
-                <conditional name="constraintLocation">
-                    <param name="constraintSelector" type="select" label="Constraints">
-                        <!-- <option value="fromInput">The constraints are included in the input file</option> -->
-                        <option value="fromFile">The constraints are in a seperate file</option>
-			            <option value="inFile">The constraints are in the fasta input file</option>
-                        <option value="none" selected="true">Don't use constraints</option>
-                    </param>
-                    <!--	<when value="fromInput"></when> -->
-                    <when value="none"></when>
-                    <when value="inFile"></when>
-                    <when value="fromFile">
-                        <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/>
-                        <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue=""
-                            label="Use constraints for all alignment records"
-                            help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them."
-                            argument="--batch"/>
-                        <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint" />
-                        <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint" />
-                    </when>
-                </conditional>
-                  <conditional name="shapeOption">
-                        <param name="shapeSelector" type="select" label="Shape reactivity data">
-                            <option value="isUsed">Use shape reactivity data</option>
-                            <option value="notUsed" selected="true">Don't use shape reactivity data</option>
+            <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
+            <conditional name="constraintLocation">
+                <param name="constraintSelector" type="select" label="Constraints">
+                    <!-- <option value="fromInput">The constraints are included in the input file</option> -->
+                    <option value="fromFile">The constraints are in a seperate file</option>
+                    <option value="inFile">The constraints are in the fasta input file</option>
+                    <option value="none" selected="true">Don't use constraints</option>
+                </param>
+                <!--	<when value="fromInput"></when> -->
+                <when value="none"/>
+                <when value="inFile"/>
+                <when value="fromFile">
+                    <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/>
+                    <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" label="Use constraints for all alignment records" help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them." argument="--batch"/>
+                    <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint"/>
+                    <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint"/>
+                </when>
+            </conditional>
+            <conditional name="shapeOption">
+                <param name="shapeSelector" type="select" label="Shape reactivity data">
+                    <option value="isUsed">Use shape reactivity data</option>
+                    <option value="notUsed" selected="true">Don't use shape reactivity data</option>
+                </param>
+                <when value="isUsed">
+                    <param type="data" name="shapeFile" format="txt" label="Shape file" argument="--shape"/>
+                    <conditional name="shapeMethod">
+                        <param name="methodSelector" type="select" label="Shape reactivity data" argument="--shapeMethod">
+                            <option value="D" selected="true">D: Convert by using a linear equation according to Deigan et al 2009</option>
+                            <option value="Z">Z: Convert SHAPE reactivities to pseudo energies according to Zarringhalam et al 2012.</option>
+                            <option value="W">W: Apply a given vector of perturbation energies to unpaired nucleotides according to Washietl et al 2012</option>
                         </param>
-                        <when value ="isUsed">
-                            <param type="data" name="shapeFile" format="txt" label="Shape file" argument="--shape"/>
-                            <conditional name="shapeMethod">
-                                <param name="methodSelector" type="select" label="Shape reactivity data" argument="--shapeMethod">
-                                    <option value="D" selected="true">D: Convert by using a linear equation according to Deigan et al 2009</option>
-                                    <option value="Z">Z: Convert SHAPE reactivities to pseudo energies according to Zarringhalam et al 2012.</option>
-                                    <option value="W">W: Apply a given vector of perturbation energies to unpaired nucleotides according to Washietl et al 2012</option>
+                        <when value="D">
+                            <param name="m" type="float" value="1.8" label="Slope m"/>
+                            <param name="b" type="float" value="-0.6" label="Intercept"/>
+                        </when>
+                        <when value="Z">
+                            <param name="b" type="float" value="-0.6" label="Intercept"/>
+                            <conditional name="shapeConversion">
+                                <param name="conversionSelector" type="select" label="shape reactivity data">
+                                    <option value="M">M: Use linear mapping according to Zarringhalam et al</option>
+                                    <option value="C">C: Use a cutoff−approach to divide into paired and unpaired nucleotides</option>
+                                    <option value="S">S: Skip the normalizing step since the input data already represents probabilities for being unpaired rather than raw reactivity values</option>
+                                    <option value="L">L: Use a linear model to convert the reactivity into a probability for being unpaired</option>
+                                    <option value="O" selected="true">O: Use a linear model to convert the log of the reactivity into a probability for being unpaired</option>
                                 </param>
-                                <when value="D">
-                                    <param name="m" type="float" value="1.8" label="Slope m"/>
-                                    <param name="b" type="float" value="-0.6" label="Intercept"/>
-                                </when>
-                                <when value="Z">
-                                    <param name="b" type="float" value="-0.6" label="Intercept"/>
-                                    <conditional name="shapeConversion">
-                                        <param name="conversionSelector" type="select" label="shape reactivity data">
-                                            <option value="M">M: Use linear mapping according to Zarringhalam et al</option>
-                                            <option value="C">C: Use a cutoff−approach to divide into paired and unpaired nucleotides</option>
-                                            <option value="S">S: Skip the normalizing step since the input data already represents probabilities for being unpaired rather than raw reactivity values</option>
-                                            <option value="L">L: Use a linear model to convert the reactivity into a probability for being unpaired</option>
-                                            <option value="O" selected="true">O: Use a linear model to convert the log of the reactivity into a probability for being unpaired</option>
-                                        </param>
-                                        <when value="M">
-                                        </when>
-                                        <when value="C">
-                                            <param name="c" type="float" value="0.25" label="Cutoff"/>
-                                        </when>
-                                        <when value="S">
+                                <when value="M">
                                         </when>
-                                        <when value="L">
-                                            <param name="s" type="float" value="0.68" label="Slope"/>
-                                            <param name="i" type="float" value="0.2" label="Intercept"/>
-                                        </when>
-                                        <when value="O">
-                                            <param name="s" type="float" value="1.6" label="Slope s"/>
-                                            <param name="i" type="float" value="-2.29" label="Intercept"/>
+                                <when value="C">
+                                    <param name="c" type="float" value="0.25" label="Cutoff"/>
+                                </when>
+                                <when value="S">
                                         </when>
-                                    </conditional>
+                                <when value="L">
+                                    <param name="s" type="float" value="0.68" label="Slope"/>
+                                    <param name="i" type="float" value="0.2" label="Intercept"/>
                                 </when>
-                                <when value="W">
+                                <when value="O">
+                                    <param name="s" type="float" value="1.6" label="Slope s"/>
+                                    <param name="i" type="float" value="-2.29" label="Intercept"/>
                                 </when>
                             </conditional>
                         </when>
-                        <when value="notUsed">
+                        <when value="W">
+                                </when>
+                    </conditional>
+                </when>
+                <when value="notUsed">
                         </when>
-                </conditional>
-                <param argument="--motif" type="text" value="" label="Sequence structure energy" help="Specify stabilizing effect of ligand binding to a particular sequence/structure motif. Some ligands binding to RNAs require and/or induce particular sequence and structure motifs. For instance they bind to an interior loop, or small hairpin loop. If for such cases a binding free energy is known, the binding and therefore stabilizing effect of the ligand can be included in the folding recursions. Interior loop motifs are specified as concatenations of 5’ and 3’ motif, separated by an ’&amp;’ character. Energy contributions must be specified in kcal/mol.">
-                    <sanitizer>
-                        <valid initial="string.printable">
+            </conditional>
+            <param argument="--motif" type="text" value="" label="Sequence structure energy" help="Specify stabilizing effect of ligand binding to a particular sequence/structure motif. Some ligands binding to RNAs require and/or induce particular sequence and structure motifs. For instance they bind to an interior loop, or small hairpin loop. If for such cases a binding free energy is known, the binding and therefore stabilizing effect of the ligand can be included in the folding recursions. Interior loop motifs are specified as concatenations of 5’ and 3’ motif, separated by an ’&amp;’ character. Energy contributions must be specified in kcal/mol.">
+                <sanitizer>
+                    <valid initial="string.printable">
                         </valid>
-                    </sanitizer>
-				</param>
+                </sanitizer>
+            </param>
         </section>
         <section name="IDs" title="Naming Conventions">
-            <param name="auto_id"
-                type="boolean" truevalue="--auto-id" falsevalue="" checked="false"
-                label="Automatically generate an ID for each alignment."
-                help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence."
-                argument="--auto-id"/>
-            <param name="id_prefix"
-                type="text" value="sequence"
-                label="Prefix for automatically generated IDs (as used in output file names)"
-                help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence."
-                argument="--id-prefix"/>
-            <param name="id_digits"
-                type="integer" value="4" min="1" max="18"
-                label="The number of digits of the counter in automatically generated sequence IDs"
-                help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]."
-                argument="--id-digits"/>
-            <param name="id_start"
-                type="integer" value="1" min="0"
-                label="First number in automatically generated sequence IDs"
-                help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.."
-                argument="--id-start"/>
+            <param name="auto_id" type="boolean" truevalue="--auto-id" falsevalue="" checked="false" label="Automatically generate an ID for each alignment." help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence." argument="--auto-id"/>
+            <param name="id_prefix" type="text" value="sequence" label="Prefix for automatically generated IDs (as used in output file names)" help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence." argument="--id-prefix"/>
+            <param name="id_digits" type="integer" value="4" min="1" max="18" label="The number of digits of the counter in automatically generated sequence IDs" help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." argument="--id-digits"/>
+            <param name="id_start" type="integer" value="1" min="0" label="First number in automatically generated sequence IDs" help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.." argument="--id-start"/>
         </section>
     </inputs>
     <outputs>
         <data format="dbn" name="dot_bracket_stdout"/>
         <collection name="structure_outputs" type="list" label="rna_strcuture_eps outputs">
             <filter>advancedOptions['nops'] is False</filter>
-            <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps" />
+            <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps"/>
         </collection>
         <collection name="matrix_outputs" type="list" label="rna_matrix_eps outputs">
             <filter>pf is True</filter>
@@ -301,56 +256,67 @@
         </collection>
     </outputs>
     <tests>
-        <test>
-            <param name="select_fasta" value="true" />
-            <param name="fasta_input" value="rnafold_input1.fa"/>
+        <test expect_num_outputs="2">
+            <conditional name="input_source">
+                <param name="select_fasta" value="true"/>
+                <param name="fasta_input" value="rnafold_input1.fa"/>
+            </conditional>
             <output name="dot_bracket_stdout" file="rnafold_result1.txt"/>
         </test>
-        
-        <test>
-            <param name="select_fasta" value="true" />
-            <param name="mea" value="true" />
-            <param name="fasta_input" value="rnafold_input1.fa"/>
+        <test expect_num_outputs="2">
+            <conditional name="input_source">
+                <param name="select_fasta" value="true"/>
+                <param name="fasta_input" value="rnafold_input1.fa"/>
+            </conditional>
+            <param name="mea" value="true"/>
             <output name="dot_bracket_stdout" file="rnafold_result1_mea.txt"/>
         </test>
-        <test>
-            <param name="select_fasta" value="true" />
-            <param name="pf" value="true" />
-            <param name="fasta_input" value="rnafold_input1.fa"/>
+        <test expect_num_outputs="3">
+            <conditional name="input_source">
+                <param name="select_fasta" value="true"/>
+                <param name="fasta_input" value="rnafold_input1.fa"/>
+            </conditional>
+            <param name="pf" value="true"/>
             <output name="dot_bracket_stdout" file="rnafold_result1_pf.txt"/>
             <output_collection name="structure_outputs" type="list">
-                <element name="Anolis_caro_chrUn_GL343590.trna2_AlaAGC" file="Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps"  compare="sim_size" />
-                <element name="Anolis_caro_chrUn_GL343207.trna3_AlaAGC" file="Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps"  compare="sim_size" />
+                <element name="Anolis_caro_chrUn_GL343207.trna3_AlaAGC" file="Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps" compare="sim_size"/>
+                <element name="Anolis_caro_chrUn_GL343590.trna2_AlaAGC" file="Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps" compare="sim_size"/>
             </output_collection>
-            
             <output_collection name="matrix_outputs" type="list">
-                <element name="Anolis_caro_chrUn_GL343590.trna2_AlaAGC" file="Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps"  compare="sim_size" />
-                <element name="Anolis_caro_chrUn_GL343207.trna3_AlaAGC" file="Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps"  compare="sim_size" />
+                <element name="Anolis_caro_chrUn_GL343207.trna3_AlaAGC" file="Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps" compare="sim_size"/>
+                <element name="Anolis_caro_chrUn_GL343590.trna2_AlaAGC" file="Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps" compare="sim_size"/>
             </output_collection>
-        </test>       
-        <test>
-            <param name="select_fasta" value="true" />
-            <param name="fasta_input" value="rnafold_input2.fa"/>
+        </test>
+        <test expect_num_outputs="2">
+            <conditional name="input_source">
+                <param name="select_fasta" value="true"/>
+                <param name="fasta_input" value="rnafold_input2.fa"/>
+            </conditional>
             <param name="temperature" value="75"/>
             <output name="dot_bracket_stdout" file="rnafold_result2.txt"/>
         </test>
-        <test>
-            <param name="select_fasta" value="false" />
-            <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/>
+        <test expect_num_outputs="2">
+            <conditional name="input_source">
+                <param name="select_fasta" value="false"/>
+                <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/>
+            </conditional>
             <output name="dot_bracket_stdout" file="rnafold_result3.txt"/>
         </test>
-        <test>
-            <param name="select_fasta" value="true" />
-            <param name="fasta_input" value="sample_3.fa"/>
-            <conditional name="shapeOption">
-              <param name="shapeSelector" value="isUsed"/>
+        <test expect_num_outputs="2">
+            <conditional name="input_source">
+                <param name="select_fasta" value="true"/>
+                <param name="fasta_input" value="sample_3.fa"/>
             </conditional>
-            <param name="shapeFile" value="sample_3.react"/>
+            <section name="constraints">
+                <conditional name="shapeOption">
+                    <param name="shapeSelector" value="isUsed"/>
+                    <param name="shapeFile" value="sample_3.react"/>
+                </conditional>
+            </section>
             <output name="dot_bracket_stdout" file="sample_3_result.txt"/>
         </test>
-    
     </tests>
-    <help>
+    <help format="markdown">
 <![CDATA[
 **RNAfold**
 
@@ -391,5 +357,5 @@ RNAfold requires one input file or a plain RNA sequence
 
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaheat.xml b/tools/rna_tools/vienna_rna/rnaheat.xml
index 18f6ee85b8..fe1f885713 100644
--- a/tools/rna_tools/vienna_rna/rnaheat.xml
+++ b/tools/rna_tools/vienna_rna/rnaheat.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rnaheat" name="@EXECUTABLE@" version="@VERSION@.0">
+<tool id="viennarna_rnaheat" name="RNAheat" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Calculate energies of RNA in a temperature range</description>
     <macros>
         <token name="@EXECUTABLE@">RNAheat</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />    
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAheat < '$input' > '$output'
     --Tmin $tmin --Tmax $tmax -d$dangling --stepsize=$stepsize --ipoints=$ipoints
     #if $varExists('$advancedOptions.noconversion')
@@ -23,68 +23,60 @@
     #end if
 ]]>
     </command>
-
     <inputs>
-        <param format="fasta" name="input" type="data" label="Input file"/>
-        <param name="tmin" type="float" value="0.0" label="minimal temperature [°C]" help="--Tmin"/>
-        <param name="tmax" type="float" value="100.0" label="maximal temperature [°C]" help="--Tmax"/>
-        <param name="stepsize" type="float" value="1.0" label="stepsize [°C]" help="--stepsize"/>
-        <param name="ipoints" type="integer" value="2" label="data points to fit parabola to: 2*value+1" help="--ipoints"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param format="fasta" name="input" type="data" label="Input FASTA file"/>
+        <param name="tmin" type="float" value="0.0" label="Minimal temperature [°C]" help="--Tmin"/>
+        <param name="tmax" type="float" value="100.0" label="Maximal temperature [°C]" help="--Tmax"/>
+        <param name="stepsize" type="float" value="1.0" label="Temperature step size [°C]" help="--stepsize"/>
+        <param name="ipoints" type="integer" value="2" label="Data points to fit parabola to: 2*value+1" help="--ipoints"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="0">0: ignore dangling ends</option>
             <option value="1">1: unpaired bases participate in one dangling end only</option>
-            <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+            <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>
-                <param argument="--nsp" type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs."
-                   help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." />
-            </when>
-            <when value="basic">
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
+                <param argument="--nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs."/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnaheat_input1.fa"/>
-            <output name="out_file" file="rnaheat_result1.txt"/>
+            <output name="output" file="rnaheat_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAheat**
 
-Calculates the specific heat of RNA sequences in the temperature range t1 to t2, from the partition function by numeric differentiation. The program fits a parabola to 2*ipoints+1 data points to calculate 2nd derivatives. Increasing this parameter produces a smoother curve.
-
+Calculates the specific heat of RNA sequences in a temperature range by numeric differentiation of the partition function. A parabola is fit to 2*ipoints+1 data points to calculate the 2nd derivative. Increasing the ipoints parameter produces a smoother curve.
 
 -----
 
 **Input format**
 
-RNAheat requires one input file Fasta format.
-
+RNAheat requires one FASTA file.
 
-------
+-----
 
 **Outputs**
 
-The result is written as a list of pairs of temperature in C and specific heat in Kcal/(Mol*K) for each sequence in the input file.
-
-
+A list of pairs: temperature (°C) and specific heat (kcal/(mol*K)) for each sequence in the input file.
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnainverse.xml b/tools/rna_tools/vienna_rna/rnainverse.xml
index ce544ef55d..8f35d44759 100644
--- a/tools/rna_tools/vienna_rna/rnainverse.xml
+++ b/tools/rna_tools/vienna_rna/rnainverse.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rnainverse" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>Calculate RNA sequence from secondary structure</description>    
+<tool id="viennarna_rnainverse" name="RNAinverse" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Calculate RNA sequence from secondary structure</description>
     <macros>
         <token name="@EXECUTABLE@">RNAinverse</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAinverse < '$input' > '$outfile'
     --function=#echo ''.join(str($algo).split(','))
     -R$reps
@@ -21,43 +21,39 @@
 ]]>
     </command>
     <inputs>
-        <param format="fasta" name="input" type="data" label="Clustal alignment file"/>
+        <param format="fasta" name="input" type="data" label="Input file (structure in dot-bracket notation, then starting sequence)"/>
         <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
-
-        <param name="reps" type="integer" value="1" min="1" label="Find so many sequences that fold close to that structure" help="-R: This parameter could be negative to search for exact solutions, but in that case the program might not terminate. If you need this functionality contact your admin or run the program locally."/>
-
-        <param name="algo" type="select" multiple="true" display="checkboxes" label="Use these functions" argument="--function">
-                <option value="m" selected="true">minimum energy</option>
-                <option value="p">partition function</option>
+        <param name="reps" type="integer" value="1" min="1" label="Number of sequences to find that fold close to that structure" help="-R"/>
+        <param argument="--function" name="algo" type="select" multiple="true" label="Algorithm to use">
+            <option value="m" selected="true">Minimum energy</option>
+            <option value="p">Partition function</option>
+            <validator type="no_options" message="Please select at least one algorithm."/>
         </param>
-        <param name="final" type="float" value="0.0" label="If partition function is selected this value determines the convergence criterium." help="--final"/>
-
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param name="final" type="float" value="0.0" label="Convergence criterion (partition function only)" help="--final"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="2" selected="true">unpaired bases participate in all dangling ends (2)</option>
             <option value="0">ignore dangling ends (0)</option>
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
-
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select"  label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-            </when>
-            <when value="basic">
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="outfile"/>
+        <data format="txt" name="outfile" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnainverse_input1.clu"/>
             <output name="outfile">
                 <assert_contents>
@@ -66,26 +62,23 @@
             </output>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNAinverse**
 
-The program searches for sequences folding into a predefined structure, thereby inverting the folding algorithm. For each search the best sequence found and its Hamming distance to the start sequence are printed. If the the search was unsuccessful, a structure distance to the target is appended.
-
+Searches for sequences folding into a predefined structure, thereby inverting the folding algorithm. For each search the best sequence found and its Hamming distance to the start sequence are printed. If the search was unsuccessful, a structure distance to the target is appended.
 
 -----
 
 **Input format**
 
-Input is similar to a Fasta file. First line should be the structure in dot-bracket notation, second line the starting sequence. Lines with '>' in the beginning are treated as comments. Characters in the start sequence other than "AUGC" will be treated as wild cards and replaced by a random character. Any lower case characters in the start sequence will be kept fixed during the search. If necessary, the sequence will be elongated to the length of the structure. Thus a string of "N"s as well as a blank line specify a random start sequence.
+Input is similar to FASTA format. First line: structure in dot-bracket notation; second line: starting sequence. Characters in the start sequence other than "AUGC" are treated as wildcards. Lower case characters are kept fixed during the search.
 
-------
+-----
 
 **Outputs**
 
-- text output of each sequence with its Hamming distance and/or the energy if the partition function is selected
-
+- Text output: each sequence with its Hamming distance and optionally the energy if partition function is selected
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnalalifold.xml b/tools/rna_tools/vienna_rna/rnalalifold.xml
index 6767361d21..187ed0d678 100644
--- a/tools/rna_tools/vienna_rna/rnalalifold.xml
+++ b/tools/rna_tools/vienna_rna/rnalalifold.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rnalalifold" name="@EXECUTABLE@" version="@VERSION@.0">
+<tool id="viennarna_rnalalifold" name="RNALalifold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Calculate locally stable secondary structures for a set of aligned RNAs</description>
     <macros>
         <token name="@EXECUTABLE@">RNALalifold</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNALalifold '$input' > '$output'
     -T$temperature -d$dangling
     -L$span
@@ -24,74 +24,60 @@
     #end if
 ]]>
     </command>
-
     <inputs>
-        <param format="txt" name="input" type="data" label="Clustal file"/>
-        <param name="span" type="integer" min="0" max="5000" value="60" label="base pair span" help="Maximal distance between two paired bases. (-L)"/>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param format="txt" name="input" type="data" label="Clustal alignment file"/>
+        <param name="span" type="integer" min="0" max="5000" value="60" label="Base pair span" help="Maximal distance between two paired bases (-L)"/>
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="0">0: ignore dangling ends</option>
             <option value="1">1: unpaired bases participate in one dangling end only</option>
-            <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+            <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <!-- the -p option led to segmentation faults with version 2.1.2 and 2.1.7, it was later removed from verion 2.1.10 -->
-        <!--<param name="pf" type="boolean" checked="false" truevalue="-p" falsevalue="" label="calculate partition function" help="-p"/>-->
-        <param name="mis" type="boolean" checked="false" truevalue="--mis" falsevalue="" label="Most Informative Sequence" help="--mis"/>
+        <param argument="--mis" name="mis" type="boolean" checked="false" truevalue="--mis" falsevalue="" label="Most Informative Sequence output"/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-               <!-- the -cutoff option was removed from version 2.2.10 -->
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="cfactor" type="float" value="1.0" label="Weight of the covariance term" help="--cfactor"/>
-                <param name="nfactor" type="float" value="1.0" label="Penalty for non-compatible sequences in the covariance term" help="--nfactor"/>
-                <param name="ribosum" type="boolean" truevalue="--ribosum_scoring" falsevalue="" checked="false" label="Use ribosum scoring matrix" help="--ribosum_scoring"/>
-            </when>
-            <when value="basic">
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--cfactor" name="cfactor" type="float" value="1.0" label="Weight of the covariance term"/>
+                <param argument="--nfactor" name="nfactor" type="float" value="1.0" label="Penalty for non-compatible sequences in the covariance term"/>
+                <param argument="--ribosum_scoring" name="ribosum" type="boolean" truevalue="--ribosum_scoring" falsevalue="" checked="false" label="Use ribosum scoring matrix"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output" />
-        <!-- the program does not seem to generate a dot plot, even though that is implied in the help -->
-        <!--<data format="tar" name="imagesFile" label="RNALalifold images"/>-->
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnalalifold_input1.clustal"/>
             <output name="output" file="rnalalifold_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNALalifold**
 
-Calculates locally stable RNA secondary structure with a maximal base pair span. For a sequence of length n and a base pair span of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to "scan" very large genomes for short RNA
-
+Calculates locally stable RNA secondary structures with a maximal base pair span for a set of aligned RNAs. For a sequence of length n and a base pair span of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to scan very large genomes for short RNA structures.
 
 -----
 
 **Input format**
 
-RNALalifold requires one input file
-- Clustal file
+RNALalifold requires one Clustal alignment file.
 
-------
+-----
 
 **Outputs**
 
-- energy of the consensus structures in the clustal file
-- several possible postscript images bundled together in a tar file
-
-
+- Energy of the consensus structures in the alignment
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnalfold.xml b/tools/rna_tools/vienna_rna/rnalfold.xml
index 7620857d3b..555e783043 100644
--- a/tools/rna_tools/vienna_rna/rnalfold.xml
+++ b/tools/rna_tools/vienna_rna/rnalfold.xml
@@ -1,16 +1,15 @@
-<tool id="viennarna_rnalfold" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>calculates locally stable secondary structures of RNA</description>
-
+<tool id="viennarna_rnalfold" name="RNALfold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Calculate locally stable secondary structures of RNA</description>
     <macros>
         <token name="@EXECUTABLE@">RNALfold</token>
         <import>macros.xml</import>
     </macros>
-        <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
-    RNALfold -L $span -T $temperature -d$dangling < '$fasta_input' 
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
+    RNALfold -L $span -T $temperature -d$dangling < '$fasta_input'
     #if $varExists('$advancedOptions.noconversion')
         $advancedOptions.noconversion
         $advancedOptions.gquad
@@ -18,8 +17,8 @@
         $advancedOptions.nogu
         $advancedOptions.noclosinggu
         $advancedOptions.notetra
-        #if $advancedOptions.activateZscore 
-            #if str($advancedOptions.zscore) <> ""
+        #if $advancedOptions.activateZscore
+            #if str($advancedOptions.zscore) != ""
                 --zscore=$advancedOptions.zscore
             #else
                 --zscore
@@ -30,69 +29,61 @@
 ]]>
     </command>
     <inputs>
-    <param format="fasta" name="fasta_input" type="data" label="FASTA file"/>
-        <param name="span" type="integer" min="0" max="5000" value="150" label="base pair span" help="Maximal distance between two paired bases. (-L)"/>
+        <param format="fasta" name="fasta_input" type="data" label="FASTA file"/>
+        <param name="span" type="integer" min="0" max="5000" value="150" label="Base pair span" help="Maximal distance between two paired bases (-L)"/>
         <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="2" selected="true">unpaired bases participate in all dangling ends (2)</option>
             <option value="0">ignore dangling ends (0)</option>
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select"  label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="Take G Quadruplex formation into account" argument="-g"/>
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>                
-                <param name="activateZscore" type="boolean" checked="false" label="Activate Z−score computation. An optional argument may be supplied to set the threshold" help="(--zscore)"/>
-                <param name="zscore" type="float" value="-2" optional="true" label="Z-score" help="An optional argument may be supplied to set the threshold"/>
-            </when>
-            <when value="basic">
+                <param argument="-g" name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="Take G Quadruplex formation into account"/>
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
+                <param name="activateZscore" type="boolean" checked="false" truevalue="true" falsevalue="" label="Activate Z-score computation" help="--zscore"/>
+                <param argument="--zscore" name="zscore" type="float" value="-2" optional="true" label="Z-score threshold"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="out_file"/>
+        <data format="txt" name="out_file" label="${tool.name} on ${on_string}"/>
     </outputs>
-
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="fasta_input" value="rnalfold_input1.fa"/>
             <output name="out_file" file="rnalfold_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
+    <help format="markdown"><![CDATA[
 **RNALfold**
 
-Compute locally stable RNA secondary structure with a maximal base pair span.
-For a sequence of length n and a base pair span of L the algorithm uses only
-O(n+L*L) memory and O(n*L*L) CPU time. *Thus it is practical to "scan" very
-large genomes for short RNA structures*.
-Output consists of a list of secondary structure components of size <= L, one
-entry per line. Each output line contains the predicted local structure its
-energy in kcal/mol and the starting position of the local structure.
+Computes locally stable RNA secondary structures with a maximal base pair span. For a sequence of length n and a base pair span of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time, making it practical to scan very large genomes for short RNA structures.
+
+Output consists of secondary structure components of size <= L, one entry per line. Each line contains the predicted local structure, its energy in kcal/mol, and the starting position.
 
 -----
 
 **Input format**
 
-- RNALfold requires one input file in FASTA format
+RNALfold requires one FASTA file.
 
-------
+-----
 
 **Outputs**
 
-- text output with dot-bracket notation and free energies of the secondary structures
-
+- Text output with dot-bracket notation and free energies of locally stable structures
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnapaln.xml b/tools/rna_tools/vienna_rna/rnapaln.xml
index 9b20b6085c..bdff959feb 100644
--- a/tools/rna_tools/vienna_rna/rnapaln.xml
+++ b/tools/rna_tools/vienna_rna/rnapaln.xml
@@ -1,15 +1,14 @@
-<tool id="viennarna_rnapaln" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>RNA alignment based on sequence base pairing propensities
-    </description>
+<tool id="viennarna_rnapaln" name="RNApaln" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>RNA alignment based on sequence base pairing propensities</description>
     <macros>
         <token name="@EXECUTABLE@">RNApaln</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNApaln < '$input' > '$output'
     --mode=$alignmentmode
     -T$temperature -d$dangling
@@ -25,88 +24,78 @@
         $advancedOptions.noclosinggu
         $advancedOptions.notetra
     #end if
-    #if $backtrack and str($alignmentmode)=="m"
-        && cat backtrack.file >> '$outfile'
+    #if $backtrack and str($alignmentmode) == "m"
+        && cat backtrack.file >> '$output'
     #end if
 ]]>
     </command>
-
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
+        <param format="fasta" name="input" type="data" label="FASTA file"/>
         <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
         <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="0">0: ignore dangling ends</option>
             <option value="1">1: unpaired bases participate in one dangling end only</option>
-            <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+            <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param name="alignmentmode" type="select" label="Comparison Option" help="--mode">
-            <option value="p" selected="True">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
+        <param argument="--mode" name="alignmentmode" type="select" label="Comparison Option">
+            <option value="p" selected="true">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
             <option value="m">m: matrix (each with each, output in matrix form)</option>
-            <option value="f" >f: first (1st with 2nd, 1st with 3rd, ...)</option>
+            <option value="f">f: first (1st with 2nd, 1st with 3rd, ...)</option>
             <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option>
         </param>
-
-        <!-- In versions 2.1.2, 2.1.7, and 2.2.10 the alignment score is wrong if -B is not selected, therefore the default for this option is set to true -->
-        <param name="backtrack" type="boolean" checked="true" truevalue="-B" falsevalue="" label="Print an alignment" help="-B"/>
-
-        <param name="gapo" type="float" value="1.5" label="gap open penalty" help="--gapo"/>
-        <param name="gape" type="float" value="0.67" label="gap extension penalty" help="--gape"/>
-        <param name="seqw" type="float" value="0.5" label="weight of sequence compared to structure" help="--seqw"/>
-        <param name="endgaps" type="boolean" checked="false" truevalue="--endgaps" falsevalue="" label="Allow free end-gaps" help="--endgaps"/>
-
+        <param argument="-B" name="backtrack" type="boolean" checked="true" truevalue="-B" falsevalue="" label="Print an alignment"/>
+        <param argument="--gapo" name="gapo" type="float" value="1.5" label="Gap open penalty"/>
+        <param argument="--gape" name="gape" type="float" value="0.67" label="Gap extension penalty"/>
+        <param argument="--seqw" name="seqw" type="float" value="0.5" label="Weight of sequence compared to structure"/>
+        <param argument="--endgaps" name="endgaps" type="boolean" checked="false" truevalue="--endgaps" falsevalue="" label="Allow free end-gaps"/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>                
-            </when>
-            <when value="basic">
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
-        <collection name="matrix_outputs" type="list" label="rna_eps outputs">
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
+        <collection name="matrix_outputs" type="list" label="${tool.name} dot plots on ${on_string}">
             <discover_datasets pattern="(?P&lt;designation&gt;.+)_dp\.ps" ext="rna_eps" visible="true"/>
         </collection>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnapaln_input1.fa"/>
-            <output name="out_file" file="rnapaln_result1.txt"/>
+            <output name="output" file="rnapaln_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNApaln**
 
 RNA alignment based on sequence base pairing propensities.
 
-Uses string-alignment techniques to perform fast pairwise structural alignments of RNAs. Similar to RNApdist secondary structure is incorporated in an approximate manner by computing base pair probabilities, which are then reduced to a vector holding the probability that a base is paired upstream, downstream, or remains unpaired. Such pair propsensity vectors can then be compared using standard alignment algorithms. In contrast to RNApdist, RNApaln performs similarity (instead of distance) alignments, considers both sequence and structure information, and uses affine (rather than linear) gap costs. RNApaln can perform semi-local alignments by using free end gaps, a true local alignment mode is planned.
+Uses string-alignment techniques to perform fast pairwise structural alignments of RNAs. Similar to RNApdist, secondary structure is incorporated in an approximate manner by computing base pair probabilities, which are then reduced to a vector holding the probability that a base is paired upstream, downstream, or remains unpaired. Such pair propensity vectors can then be compared using standard alignment algorithms. In contrast to RNApdist, RNApaln performs similarity (instead of distance) alignments, considers both sequence and structure information, and uses affine (rather than linear) gap costs.
 
 -----
 
 **Input format**
 
-RNApaln requires one input file
-- Fasta file
+RNApaln requires one FASTA file.
 
-------
+-----
 
 **Outputs**
 
-- output of alignment scores and alignments (if -B option is selected)
-- dot plot matrices in postscript format bundled together in a tar file
-
+- Alignment scores and alignments (if -B option is selected)
+- Dot plot matrices in PostScript format
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnapdist.xml b/tools/rna_tools/vienna_rna/rnapdist.xml
index 568e25b4d1..d40daabcd4 100644
--- a/tools/rna_tools/vienna_rna/rnapdist.xml
+++ b/tools/rna_tools/vienna_rna/rnapdist.xml
@@ -1,16 +1,14 @@
-<tool id="viennarna_rnadpdist" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>Calculate distances between thermodynamic RNA secondary structure ensembles
-    </description>
-
+<tool id="viennarna_rnadpdist" name="RNApdist" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Calculate distances between thermodynamic RNA secondary structure ensembles</description>
     <macros>
         <token name="@EXECUTABLE@">RNApdist</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNApdist < '$input' > '$output'
     --compare=$compare
     -T$temperature -d$dangling
@@ -22,80 +20,72 @@
         $advancedOptions.noclosinggu
         $advancedOptions.notetra
     #end if
-    #if $backtrack and str($compare)=="m"
-        && cat backtrack.file >> '$outfile'
+    #if $backtrack and str($compare) == "m"
+        && cat backtrack.file >> '$output'
     #end if
-
 ]]>
     </command>
-
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
+        <param format="fasta" name="input" type="data" label="FASTA file"/>
         <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
         <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="0">0: ignore dangling ends</option>
             <option value="1">1: unpaired bases participate in one dangling end only</option>
-            <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
+            <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param name="compare" type="select" label="Comparison Option" help="--compare">
-            <option value="p" selected="True">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
+        <param argument="--compare" name="compare" type="select" label="Comparison Option">
+            <option value="p" selected="true">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
             <option value="m">m: matrix (each with each, output in matrix form)</option>
-            <option value="f" >f: first (1st with 2nd, 1st with 3rd, ...)</option>
+            <option value="f">f: first (1st with 2nd, 1st with 3rd, ...)</option>
             <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option>
         </param>
-        <param name="backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment" help="--backtrack"/>
+        <param argument="--backtrack" name="backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment"/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>
-            </when>
-            <when value="basic">
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
-        <data format="txt" name="dotplot"/>
-        <collection name="matrix_outputs" type="list" label="rna_eps outputs">
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
+        <collection name="matrix_outputs" type="list" label="${tool.name} dot plots on ${on_string}">
             <discover_datasets pattern="(?P&lt;designation&gt;.+)_dp\.ps" ext="rna_eps" visible="true"/>
         </collection>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnapdist_input1.fa"/>
-            <output name="out_file" file="rnapdist_result1.txt"/>
+            <output name="output" file="rnapdist_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNApdist**
 
-RNApdist calculates structure distances between the thermodynamic ensembles of the secondary structures of RNA sequences.
+Calculates structure distances between the thermodynamic ensembles of the secondary structures of RNA sequences.
 
 -----
 
 **Input format**
 
-RNApdist requires one input file
-- Fasta file
+RNApdist requires one FASTA file.
 
-------
+-----
 
 **Outputs**
 
-- output of alignment scores and alignments (if -B option is selected)
-- dot plot matrices in postscript format bundled together in a tar file
-
+- Distance scores between sequence pairs
+- Dot plot matrices in PostScript format
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnapkplex.xml b/tools/rna_tools/vienna_rna/rnapkplex.xml
index 39254df23f..c17fc84849 100644
--- a/tools/rna_tools/vienna_rna/rnapkplex.xml
+++ b/tools/rna_tools/vienna_rna/rnapkplex.xml
@@ -1,15 +1,14 @@
-<tool id="viennarna_rnapkplex" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description> predicts RNA secondary structures including pseudoknots</description>
-
+<tool id="viennarna_rnapkplex" name="RNAPKplex" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Predict RNA secondary structures including pseudoknots</description>
     <macros>
         <token name="@EXECUTABLE@">RNAPKplex</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAPKplex < '$input' > '$output'
     -T$temperature
     --energyCutoff=$energycutoff
@@ -25,71 +24,60 @@
     #end if
 ]]>
     </command>
-
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="energycutoff" type="float" value="-8.1" label="Pseudoknots cutoff. Pseudoknots with smaller energy gains are rejected." help="--energyCutoff"/>
+        <param format="fasta" name="input" type="data" label="FASTA file"/>
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param argument="--energyCutoff" name="energycutoff" type="float" value="-8.1" label="Pseudoknots cutoff" help="Pseudoknots with smaller energy gains are rejected."/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="suboptimal" type="float" value="0.0" label="Print suboptimal pseudoknots" help="--subopts"/>
-                <param name="verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Verbose mode, more output" help="--verbose"/>
-                <param name="cutoff" type="float" value="0.01" label="cutoff probability for the reporting of the base pairs in the dot plot" help="--cutoff"/>
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>                
-            </when>
-            <when value="basic">
+                <param argument="--subopts" name="suboptimal" type="float" value="0.0" label="Print suboptimal pseudoknots"/>
+                <param argument="--verbose" name="verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Verbose mode, more output"/>
+                <param argument="--cutoff" name="cutoff" type="float" value="0.01" label="Cutoff probability for base pairs in the dot plot"/>
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
-        <collection name="matrix_outputs" type="list" label="rna_eps outputs">
-            <discover_datasets pattern="(?P&lt;designation&gt;.+)\.ps" ext="eps" />
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
+        <collection name="matrix_outputs" type="list" label="${tool.name} structure plots on ${on_string}">
+            <discover_datasets pattern="(?P&lt;designation&gt;.+)\.ps" ext="eps"/>
         </collection>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnapkplex_input1.fa"/>
-            <output name="out_file" file="rnapkplex_result1.txt"/>
+            <output name="output" file="rnapkplex_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNAPKplex**
 
 Computes RNA secondary structures by first making two sequence intervals accessible and unpaired using the algorithm of RNAplfold and then calculating the energy of the interaction of those two intervals. The algorithm uses O(n^2*w^4) CPU time and O(n*w^2) memory space. The algorithm furthermore always considers dangle=2 model.
 
-It also produces a PostScript file with a plot of the pseudoknot-free secondary structure graph, in which the bases forming the pseuodknot are marked red.
-
-For each structure in the Fasta input, a PostScript file is produced for the structure graph.
+It also produces a PostScript file with a plot of the pseudoknot-free secondary structure graph, in which the bases forming the pseudoknot are marked red.
 
 -----
 
 **Input format**
 
-RNAPKplex requires one input file
+RNAPKplex requires one FASTA file. The input format is similar to FASTA except that even long sequences may not be interrupted by line breaks, and the header lines are optional.
 
-- fasta file
-
-The input format is similar to fasta except that even long sequences may not be interrupted by line breaks, and the header lines are optional.
-
-------
+-----
 
 **Outputs**
 
-- secondary structure in dot-bracket format
+- Secondary structure in dot-bracket format
 - Images of the calculated structures
-
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaplex.xml b/tools/rna_tools/vienna_rna/rnaplex.xml
index 83ee409d9a..2cd7eb4901 100644
--- a/tools/rna_tools/vienna_rna/rnaplex.xml
+++ b/tools/rna_tools/vienna_rna/rnaplex.xml
@@ -1,21 +1,20 @@
-<tool id="viennarna_rnaplex" name="@EXECUTABLE@" version="@VERSION@.0">
+<tool id="viennarna_rnaplex" name="RNAplex" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Find targets of a query RNA</description>
-    
     <macros>
         <token name="@EXECUTABLE@">RNAplex</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAplex
     #if str($clustalOption.clustalFlag) == "clustal"
         --alignment-mode
-        -q'$input1' -t'$input2'
+        -q'$clustalOption.input1' -t'$clustalOption.input2'
     #else
-        < '$input'
+        < '$clustalOption.input'
     #end if
     -T$temperature
     --interaction-length=$maxLength
@@ -38,93 +37,85 @@
     > '$output'
 ]]>
     </command>
-
     <inputs>
-    <conditional name="clustalOption">
-        <param name="clustalFlag" type="select" label="Input options">
-            <option value="fasta" selected="true">Fasta input file</option>
-            <option value="clustal">Clustalw input files</option>
-        </param>
-        <when value="fasta">
-            <param format="fasta" name="input" type="data" label="Fasta file"/>
-            <conditional name="meltingOption">
-                <param name="meltingSelector" type="select" label="calculate melting temperature">
-                    <option value="no" selected="true">no</option>
-                    <option value="yes">yes</option>
-                </param>
-                <when value="yes">
-                    <param name="probeConc" type="float" value="0.1" label="Concentration of the probe" help="--probe-concentration"/>
-                    <param name="naConc" type="float" value="1.0" label="Na concentration" help="--na-concentration"/>
-                    <param name="mgConc" type="float" value="1.0" label="Mg concentration" help="--mg-concentration"/>
-                    <param name="kConc" type="float" value="1.0" label="K concentration" help="--k-concentration"/>
-                    <param name="trisConc" type="float" value="1.0" label="Tris concentration" help="--tris-concentration"/>
-                </when>
-                <when value="no">
-                </when>
-            </conditional>
+        <conditional name="clustalOption">
+            <param name="clustalFlag" type="select" label="Input options">
+                <option value="fasta" selected="true">FASTA input file</option>
+                <option value="clustal">ClustalW input files</option>
+            </param>
+            <when value="fasta">
+                <param format="fasta" name="input" type="data" label="FASTA file"/>
+                <conditional name="meltingOption">
+                    <param name="meltingSelector" type="select" label="Calculate melting temperature">
+                        <option value="no" selected="true">No</option>
+                        <option value="yes">Yes</option>
+                    </param>
+                    <when value="yes">
+                        <param argument="--probe-concentration" name="probeConc" type="float" value="0.1" label="Concentration of the probe"/>
+                        <param argument="--na-concentration" name="naConc" type="float" value="1.0" label="Na concentration"/>
+                        <param argument="--mg-concentration" name="mgConc" type="float" value="1.0" label="Mg concentration"/>
+                        <param argument="--k-concentration" name="kConc" type="float" value="1.0" label="K concentration"/>
+                        <param argument="--tris-concentration" name="trisConc" type="float" value="1.0" label="Tris concentration"/>
+                    </when>
+                    <when value="no"/>
+                </conditional>
             </when>
-        <when value="clustal">
-            <param format="txt" name="input1" type="data" label="Clustal file / Query sequences"/>
-            <param format="txt" name="input2" type="data" label="Clustal file / Target sequences"/>
-        </when>
-    </conditional>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="maxLength" type="integer" min="0" value="40" label="maximal interaction length" help="--interaction-length"/>
-        <param name="extensionCost" type="integer" value="0" label="extension cost" help="--extension-cost"/>
-        <param name="extensionCost" type="integer" value="0" label="extension cost" help="--extension-cost"/>
-        <param name="scaleAccessibility" type="float" value="1.0" label="scale all opening energy by a factor" help="--scale-accessibility"/>
-        <param name="constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Calculate structures subject to constraints. Constraints have to be given in the input file" help="--constraint"/>
-
-
+            <when value="clustal">
+                <param format="txt" name="input1" type="data" label="Clustal file / Query sequences"/>
+                <param format="txt" name="input2" type="data" label="Clustal file / Target sequences"/>
+            </when>
+        </conditional>
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param argument="--interaction-length" name="maxLength" type="integer" min="0" value="40" label="Maximal interaction length"/>
+        <param argument="--extension-cost" name="extensionCost" type="integer" value="0" label="Extension cost"/>
+        <param argument="--scale-accessibility" name="scaleAccessibility" type="float" value="1.0" label="Scale all opening energies by a factor"/>
+        <param argument="--constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Calculate structures subject to constraints"/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="fastFolding" type="select" label="Backtracking" help="--fast-folding">
-                    <option value="0" selected="true">based on standard energy model (0) - normal</option>
-                    <option value="2">based on approximate plex model (2) - faster</option>
-                    <option value="1">no recomputation (1) - fastest</option>
+                <param argument="--fast-folding" name="fastFolding" type="select" label="Backtracking">
+                    <option value="0" selected="true">Based on standard energy model (0) - normal</option>
+                    <option value="2">Based on approximate plex model (2) - faster</option>
+                    <option value="1">No recomputation (1) - fastest</option>
                 </param>
-                <param name="duplexDistance" type="integer" value="0" label="Distance between target 3' ends of two consecutive duplexes" help="--duplex-distance"/>
-                <param name="enThreshold" type="float" value="-100000" label="Minimum Energy Gain for a Duplex [kcal/mol]" help="--energy-threshold"/>
-            </when>
-            <when value="basic">
+                <param argument="--duplex-distance" name="duplexDistance" type="integer" value="0" label="Distance between target 3' ends of two consecutive duplexes"/>
+                <param argument="--energy-threshold" name="enThreshold" type="float" value="-100000" label="Minimum energy gain for a duplex [kcal/mol]"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
-            <param name="input" value="rnaplex_input1.fa"/>
-            <output name="out_file" file="rnaplex_result1.txt"/>
+        <test expect_num_outputs="1">
+            <conditional name="clustalOption">
+                <param name="clustalFlag" value="fasta"/>
+                <param name="input" value="rnaplex_input1.fa"/>
+            </conditional>
+            <output name="output" file="rnaplex_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNAplex**
 
-Computes optimal and suboptimal secondary structures for their hybridization. The calculation is simplified by allowing only inter-molecular base pairs.
-
+Computes optimal and suboptimal secondary structures for the hybridization of two RNA sequences. The calculation is simplified by allowing only inter-molecular base pairs.
 
 -----
 
 **Input format**
 
-RNALplex requires either one Fasta file or two Clustal files as input
+RNAplex requires either one FASTA file or two ClustalW files as input.
 
-------
+-----
 
 **Outputs**
 
-The computed optimal and suboptimal structure are given, one structure per line. Each line consist of: The structure in dot bracket format with a "&" separating the two strands. The range of the structure in the two sequences in the format  "from,to : from,to"; the energy of duplex structure in kcal/mol.
-
-
+The computed optimal and suboptimal structures are given, one structure per line. Each line consists of: the structure in dot-bracket format with a "&" separating the two strands; the range of the structure in the two sequences in the format "from,to : from,to"; and the energy of duplex structure in kcal/mol.
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaplfold.xml b/tools/rna_tools/vienna_rna/rnaplfold.xml
index 4a47e63106..de01d09471 100644
--- a/tools/rna_tools/vienna_rna/rnaplfold.xml
+++ b/tools/rna_tools/vienna_rna/rnaplfold.xml
@@ -1,15 +1,14 @@
-<tool id="viennarna_rnaplfold" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description> predicts RNA secondary structures including pseudoknots</description>
-
+<tool id="viennarna_rnaplfold" name="RNAplfold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Calculate average pair probabilities over sliding windows</description>
     <macros>
         <token name="@EXECUTABLE@">RNAplfold</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAplfold < '$input'
     -T$temperature
     --dangles=$dangling
@@ -18,7 +17,7 @@
     --span=$span
     $onthefly
     $openingenergies
-    #if $varExists('$unpairedOption.ulength')
+    #if $unpairedOption.unpairedSelector == "yes"
         --ulength=$unpairedOption.ulength
     #end if
     #if $varExists('$advancedOptions.nolp')
@@ -28,98 +27,108 @@
         $advancedOptions.noclosinggu
         $advancedOptions.notetra
     #end if
-    && find -name '*_basepairs' -or -name '*_lunp' -or -name '*_openen*' > files.tmp 
-    && tar -cf '$outputf' --files-from=files.tmp
-
+    #if $onthefly or $openingenergies or $unpairedOption.unpairedSelector == "yes"
+        && find . -name '*_basepairs' -or -name '*_lunp' -or -name '*_openen*' > files.tmp
+        && tar -cf '$outputf' --files-from=files.tmp
+    #end if
 ]]>
     </command>
-
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param format="fasta" name="input" type="data" label="FASTA file"/>
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="2" selected="true">unpaired bases participate in all dangling ends (2)</option>
             <option value="0">ignore dangling ends (0)</option>
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
-        <param name="winsize" type="integer" value="70" label="Average pairing probabilities over this windowsize" help="--winsize"/>
-        <param name="span" type="integer" value="70" label="Maximum seperation between base pairs" help="--span, -L"/>
-        <param name="cutoff" type="float" value="0.01" label="Cutoff probability for report on base pairing" help="--cutoff"/>
-        <param name="onthefly" type="boolean" truevalue="--print_onthefly" falsevalue="" checked="false" label="Print simplified base pair probabilities (_basepairs output)" help="--print_onthefly"/>
-        <param name="openingenergies" type="boolean" truevalue="--opening_energies" falsevalue="" checked="false" label="Output in logarithm of the probabilities (_openen output)" help="--opening_energies"/>
-        <param argument="--plex_output" type="boolean" truevalue="--plex_output" falsevalue="" checked="false" label="" help=""/>
+        <param argument="--winsize" name="winsize" type="integer" value="70" label="Average pairing probabilities over this window size"/>
+        <param argument="--span" name="span" type="integer" value="70" label="Maximum separation between base pairs"/>
+        <param argument="--cutoff" name="cutoff" type="float" value="0.01" label="Cutoff probability for report on base pairing"/>
+        <param argument="--print_onthefly" name="onthefly" type="boolean" truevalue="--print_onthefly" falsevalue="" checked="false" label="Print simplified base pair probabilities (_basepairs output)"/>
+        <param argument="--opening_energies" name="openingenergies" type="boolean" truevalue="--opening_energies" falsevalue="" checked="false" label="Output in logarithm of the probabilities (_openen output)"/>
         <conditional name="unpairedOption">
-            <param name="unpairedSelector" type="select" label="Compute probabilty that region is unpaired (_lunp output)">
-                <option value="no" selected="true">no</option>
-                <option value="yes">yes</option>
+            <param name="unpairedSelector" type="select" label="Compute probability that region is unpaired (_lunp output)">
+                <option value="no" selected="true">No</option>
+                <option value="yes">Yes</option>
             </param>
             <when value="yes">
-                <param name="ulength" type="integer" value="31" label="Maximal lenght of unpaired region" help="--ulength"/>
-            </when>
-            <when value="no">
+                <param argument="--ulength" name="ulength" type="integer" value="31" label="Maximal length of unpaired region"/>
             </when>
+            <when value="no"/>
         </conditional>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>               
-            </when>
-            <when value="basic">
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <collection name="matrix_outputs" type="list" label="rna_eps outputs">
+        <collection name="matrix_outputs" type="list" label="${tool.name} dot plots on ${on_string}">
             <discover_datasets pattern="(?P&lt;designation&gt;.+)_dp\.ps" ext="rna_eps" visible="true"/>
         </collection>
-        <data format="tar" name="outputf"/>
+        <data format="tar" name="outputf" label="${tool.name} on ${on_string}">
+            <filter>onthefly or openingenergies or unpairedOption['unpairedSelector'] == 'yes'</filter>
+        </data>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnaplfold_input1.fa"/>
-            <output_collection name="matrix_outputs" type="list">                
+            <output_collection name="matrix_outputs" type="list">
                 <element name="Anolis_caro_chrUn_GL343590.trna2-A">
                     <assert_contents>
-                        <has_text_matching expression="%%Creator: ViennaRNA-@VERSION@" />
+                        <has_text_matching expression="%%Creator: ViennaRNA-@TOOL_VERSION@"/>
                     </assert_contents>
                 </element>
             </output_collection>
         </test>
+        <test expect_num_outputs="2">
+            <param name="input" value="rnaplfold_input1.fa"/>
+            <conditional name="unpairedOption">
+                <param name="unpairedSelector" value="yes"/>
+                <param name="ulength" value="31"/>
+            </conditional>
+            <output_collection name="matrix_outputs" type="list">
+                <element name="Anolis_caro_chrUn_GL343590.trna2-A">
+                    <assert_contents>
+                        <has_text_matching expression="%%Creator: ViennaRNA-@TOOL_VERSION@"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+            <output name="outputf">
+                <assert_contents>
+                    <has_archive_member path=".*_lunp"/>
+                </assert_contents>
+            </output>
+        </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNAplfold**
 
-Computes local pair probabilities for base pairs with a maximal span of L. The probabilities are averaged over all windows of size L that contain the base pair. For a sequence of length n and a window size of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to "scan" very large genomes for short stable RNA structures.
-
+Computes local pair probabilities for base pairs with a maximal span of L. The probabilities are averaged over all windows of size L that contain the base pair. For a sequence of length n and a window size of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to scan very large genomes for short stable RNA structures.
 
 -----
 
 **Input format**
 
-RNAPplfold requires one input file
+RNAplfold requires one FASTA file.
 
-- Fasta file
-
-------
+-----
 
 **Outputs**
 
-For each structure in the Fasta input a postscript image with dot-plot of the pairing probabilities is generated. Different output is generated with the "--ulength", "--print_onthefly" and "--opening_energies" flags.
-The Dot Plot Matrices are stored in a Postscript file.
-The other output is packed in a tar file.
-
-
+- Dot plot matrices of pairing probabilities in PostScript format
+- A tar file containing _basepairs, _lunp, and _openen outputs (depending on selected options)
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaplot.xml b/tools/rna_tools/vienna_rna/rnaplot.xml
index 32824248be..03348f579a 100644
--- a/tools/rna_tools/vienna_rna/rnaplot.xml
+++ b/tools/rna_tools/vienna_rna/rnaplot.xml
@@ -1,21 +1,25 @@
-<tool id="viennarna_rnaplot" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description> Draw RNA Secondary Structures </description>
+<tool id="viennarna_rnaplot" name="RNAplot" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Draw RNA secondary structures</description>
     <macros>
         <token name="@EXECUTABLE@">RNAplot</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAplot < '$input'
     --layout-type=$layoutSelector
     --output-format=$formatOptions.formatSelector
-    #if str($formatOptions.formatSelector) == "ps"
-        --pre=$formatOptions.pre
-        --post=$formatOptions.post
-        && tar -cf '$imagesFile' *.ps
+    #if str($formatOptions.formatSelector) == "eps"
+        #if $formatOptions.pre
+            --pre='$formatOptions.pre'
+        #end if
+        #if $formatOptions.post
+            --post='$formatOptions.post'
+        #end if
+        && tar -cf '$imagesFile' *.eps
     #elif str($formatOptions.formatSelector) == "gml"
         && tar -cf '$imagesFile' *.gml
     #elif str($formatOptions.formatSelector) == "svg"
@@ -26,36 +30,32 @@
 ]]>
     </command>
     <inputs>
-        <param format="txt,dbn" name="input" type="data" label="DotBracket structure"/>
-        <param name="layoutSelector" type="select" label="Layout selection" argument="--layout-type">
+        <param format="txt,dbn" name="input" type="data" label="DotBracket structure file"/>
+        <param argument="--layout-type" name="layoutSelector" type="select" label="Layout selection">
             <option value="0">Radial Layout</option>
             <option value="1" selected="true">Naview Layout</option>
         </param>
         <conditional name="formatOptions">
-            <param name="formatSelector" type="select" label="Output format selection" help="--output-format">
-                <option value="ps" selected="true">Postscript (.ps)</option>
+            <param argument="--output-format" name="formatSelector" type="select" label="Output format selection">
+                <option value="eps" selected="true">PostScript/EPS (.ps)</option>
                 <option value="gml">Graph Meta Language (.gml)</option>
                 <option value="svg">Scalable Vector Graphics (.svg)</option>
                 <option value="xrna">XRNA Save File (.ss)</option>
             </param>
-            <when value="ps">
-                <param name="pre" type="text" label="Add annotation macros to postscript file" help="--pre"/>
-                <param name="post" type="text" label="Add annotations to postscript file" help="--post"/>
-            </when>
-            <when value="gml">
-            </when>
-            <when value="svg">
-            </when>
-            <when value="xrna">
+            <when value="eps">
+                <param argument="--pre" name="pre" type="text" value="" optional="true" label="Add annotation macros to PostScript file"/>
+                <param argument="--post" name="post" type="text" value="" optional="true" label="Add annotations to PostScript file"/>
             </when>
+            <when value="gml"/>
+            <when value="svg"/>
+            <when value="xrna"/>
         </conditional>
     </inputs>
-
     <outputs>
-        <data format="tar" name="imagesFile"/>
+        <data format="tar" name="imagesFile" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnaplot_input1.dbn"/>
             <output name="imagesFile">
                 <assert_contents>
@@ -64,29 +64,23 @@
             </output>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNAplot**
 
-The program reads RNA sequences and structures in the format as produced by RNAfold and produces drawings of the secondary structure graph. The coordinates are produced using either E. Bruccoleri's naview routines, or a simple radial layout method.
+Reads RNA sequences and structures in the format as produced by RNAfold and produces drawings of the secondary structure graph. The coordinates are produced using either E. Bruccoleri's naview routines, or a simple radial layout method.
 
 -----
 
 **Input format**
 
-RNAplot requires one input file
+RNAplot requires one input file in dot-bracket notation (as produced by RNAfold).
 
-- Fasta file with an additional line with structure information in dot-bracket notation
-
-------
+-----
 
 **Outputs**
 
-- several possible postscript images bundled together in a tar file
-
-
+- Structure images bundled together in a tar file (PostScript, SVG, GML, or XRNA format)
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnasnoop.xml b/tools/rna_tools/vienna_rna/rnasnoop.xml
index eab1b07b30..eca6bfa430 100644
--- a/tools/rna_tools/vienna_rna/rnasnoop.xml
+++ b/tools/rna_tools/vienna_rna/rnasnoop.xml
@@ -1,16 +1,15 @@
-<tool id="viennarna_rnasnoop" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description> Find targets of a query H/ACA snoRNA</description>
-
+<tool id="viennarna_rnasnoop" name="RNAsnoop" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Find targets of a query H/ACA snoRNA</description>
     <macros>
         <token name="@EXECUTABLE@">RNAsnoop</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
-    RNAsnoop --query='$input1' --target='$input2' > '$output'
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
+    RNAsnoop --query='$filetypeOptions.input1' --target='$filetypeOptions.input2' > '$output'
     --alignmentLength=$length
     $constraint
     --energy-threshold=$energyThreshold
@@ -42,11 +41,10 @@
     #end if
 ]]>
     </command>
-
     <inputs>
         <conditional name="filetypeOptions">
-            <param name="filetypeSelector" type="select" label="Select Filetype">
-                <option value="fasta" selected="true">Fasta</option>
+            <param name="filetypeSelector" type="select" label="Select file type">
+                <option value="fasta" selected="true">FASTA</option>
                 <option value="clustal">Clustal</option>
             </param>
             <when value="fasta">
@@ -58,81 +56,75 @@
                 <param format="txt" name="input2" type="data" label="Target sequences"/>
             </when>
         </conditional>
-
-        <param name="length" type="integer" min="0" value="25" label="Maximal alignment length" help="--alignmentLength"/>
-        <param name="constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Calculate the stem structure subject to constraints" help="--constraint"/>
-        <param name="energyThreshold" type="float" value="-1.0" label="Maximal energy difference between the mfe and the desired suboptimal structure" help="--energy-threshold"/>
-
+        <param argument="--alignmentLength" name="length" type="integer" min="0" value="25" label="Maximal alignment length"/>
+        <param argument="--constraint" name="constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Calculate the stem structure subject to constraints"/>
+        <param argument="--energy-threshold" name="energyThreshold" type="float" value="-1.0" label="Maximal energy difference between the mfe and the desired suboptimal structure"/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="fast" type="boolean" truevalue="--fast-folding=1" falsevalue="--fast-folding=0" checked="true" label="Backtracking based on the standard energy model" help="--fast-folding"/>
-                <param name="extensioncost" type="integer" value="0" label="Cost to add each nucleotide in a duplex" help="--extension-cost"/>
-                <param name="minrightduplex" type="integer" value="-270" label="Minimal right duplex energy" help="--minimal-right-duplex"/>
-                <param name="minloop" type="integer" value="-280" label="Minimal Loop energy" help="--minimal-loop-energy"/>
-                <param name="minleftduplex" type="integer" value="-170" label="Minimal left duplex energy" help="--minimal-left-duplex"/>
-                <param name="minduplex" type="integer" value="-1090" label="Minimal duplex energy" help="--minimal-duplex"/>
-                <param name="duplexdist" type="integer" value="2" label="Distance between target 3' ends of two consecutive duplexes" help="--duplex-distance"/>
-                <param name="minstemlength" type="integer" value="5" label="Minimal snoRNA stem length" help="--minimal-stem-length"/>
-                <param name="maxstemlength" type="integer" value="120" label="Maximal snoRNA stem length" help="--maximal-stem-length"/>
-                <param name="minbox" type="integer" value="11" label="Minimal distance between the duplex end and the H/ACA box" help="--minimal-duplex-box-length"/>
-                <param name="maxbox" type="integer" value="16" label="Maximal distance between the duplex end and the H/ACA box" help="--maximal-duplex-box-length"/>
-                <param name="minsnornastem" type="integer" value="1" label="Minimal distance between the stem loop and the snoRNA sequence" help="--minimal-snoRNA-stem-loop-length"/>
-                <param name="maxsnornastem" type="integer" value="100000" label="Maximal distance between the stem loop and the snoRNA sequence" help="--maximal-snoRNA-stem-loop-length"/>
-                <param name="minsnornaduplex" type="integer" value="0" label="Minimal distance between the duplex and the snoRNA sequence" help="--minimal-snoRNA-duplex-length"/>
-                <param name="maxsnornaduplex" type="integer" value="0" label="Maximal distance between the duplex and the snoRNA sequence" help="--maximal-snoRNA-duplex-length"/>
-                <param name="minduplexstem" type="integer" value="-1370" label="Minimal duplex stem energy" help="--minimal-duplex-stem-energy"/>
-                <param name="mintotal" type="integer" value="100000" label="Minimal total energy" help="--minimal-total-energy"/>
-                <param name="maxstemasymmetry" type="integer" value="30" label="Maximal snoRNA stem asymmetry" help="--maximal-stem-asymmetry"/>
-                <param name="minstemenergy" type="integer" value="100000" label="Minimal lower stem energy" help="--minimal-lower-stem-energy"/>
-            </when>
-            <when value="basic">
+                <param argument="--fast-folding" name="fast" type="boolean" truevalue="--fast-folding=1" falsevalue="--fast-folding=0" checked="true" label="Backtracking based on the standard energy model"/>
+                <param argument="--extension-cost" name="extensioncost" type="integer" value="0" label="Cost to add each nucleotide in a duplex"/>
+                <param argument="--minimal-right-duplex" name="minrightduplex" type="integer" value="-270" label="Minimal right duplex energy"/>
+                <param argument="--minimal-loop-energy" name="minloop" type="integer" value="-280" label="Minimal Loop energy"/>
+                <param argument="--minimal-left-duplex" name="minleftduplex" type="integer" value="-170" label="Minimal left duplex energy"/>
+                <param argument="--minimal-duplex" name="minduplex" type="integer" value="-1090" label="Minimal duplex energy"/>
+                <param argument="--duplex-distance" name="duplexdist" type="integer" value="2" label="Distance between target 3' ends of two consecutive duplexes"/>
+                <param argument="--minimal-stem-length" name="minstemlength" type="integer" value="5" label="Minimal snoRNA stem length"/>
+                <param argument="--maximal-stem-length" name="maxstemlength" type="integer" value="120" label="Maximal snoRNA stem length"/>
+                <param argument="--minimal-duplex-box-length" name="minbox" type="integer" value="11" label="Minimal distance between the duplex end and the H/ACA box"/>
+                <param argument="--maximal-duplex-box-length" name="maxbox" type="integer" value="16" label="Maximal distance between the duplex end and the H/ACA box"/>
+                <param argument="--minimal-snoRNA-stem-loop-length" name="minsnornastem" type="integer" value="1" label="Minimal distance between the stem loop and the snoRNA sequence"/>
+                <param argument="--maximal-snoRNA-stem-loop-length" name="maxsnornastem" type="integer" value="100000" label="Maximal distance between the stem loop and the snoRNA sequence"/>
+                <param argument="--minimal-snoRNA-duplex-length" name="minsnornaduplex" type="integer" value="0" label="Minimal distance between the duplex and the snoRNA sequence"/>
+                <param argument="--maximal-snoRNA-duplex-length" name="maxsnornaduplex" type="integer" value="0" label="Maximal distance between the duplex and the snoRNA sequence"/>
+                <param argument="--minimal-duplex-stem-energy" name="minduplexstem" type="integer" value="-1370" label="Minimal duplex stem energy"/>
+                <param argument="--minimal-total-energy" name="mintotal" type="integer" value="100000" label="Minimal total energy"/>
+                <param argument="--maximal-stem-asymmetry" name="maxstemasymmetry" type="integer" value="30" label="Maximal snoRNA stem asymmetry"/>
+                <param argument="--minimal-lower-stem-energy" name="minstemenergy" type="integer" value="100000" label="Minimal lower stem energy"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
-        <data format="tar" name="imagesFile">
-             <filter>filetypeOptions['filetypeSelector'] == "fasta"</filter>
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
+        <data format="tar" name="imagesFile" label="${tool.name} images on ${on_string}">
+            <filter>filetypeOptions['filetypeSelector'] == "fasta"</filter>
         </data>
-
     </outputs>
     <tests>
-        <test>
-            <param name="input1" value="rnasnoop_input1b.fa"/>
-            <param name="input2" value="rnasnoop_input1a.fa"/>
+        <test expect_num_outputs="2">
+            <conditional name="filetypeOptions">
+                <param name="filetypeSelector" value="fasta"/>
+                <param name="input1" value="rnasnoop_input1b.fa"/>
+                <param name="input2" value="rnasnoop_input1a.fa"/>
+            </conditional>
             <output name="output" file="rnasnoop_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNAsnoop**
 
-reads a target RNA sequence and a H/ACA snoRNA sequence from a target and query file, respectively and computes optimal and suboptimal secondary structures for their hybridization. The calculation can be done roughly done in O(nm), where is n the length of the target sequence and m is the length of the snoRNA stem, as it is specially tailored to the special case of H/ACA snoRNA. For general purpose target predictions, please have a look at RNAduplex, RNAup, RNAcofold and RNAplex.
-
+Reads a target RNA sequence and a H/ACA snoRNA sequence from a target and query file, respectively, and computes optimal and suboptimal secondary structures for their hybridization. The calculation can be done roughly in O(nm), where n is the length of the target sequence and m is the length of the snoRNA stem, as it is specially tailored to H/ACA snoRNA. For general purpose target predictions, please use RNAduplex, RNAup, RNAcofold, or RNAplex.
 
 -----
 
 **Input format**
 
-RNAsnoop requires two input files
+RNAsnoop requires two input files:
 
-- either two Fasta files
-- or two Clustal alignment files
+- Either two FASTA files
+- Or two Clustal alignment files
 
-------
+-----
 
 **Outputs**
 
-The computed optimal and suboptimal structure are given, one structure per line. Each line consist of: The structure in dot bracket format with a "&" separating the two strands. The '<>' brackets represent snoRNA intramolecular interactions, while the '()' brackets represent intermolecular interactions between the snoRNA and its target.
-The range of the structure in the two sequences in the format "from,to : from,to"; the energy of duplex structure in kcal/mol. If available the opening energy are also returned.
-
-
+- Optimal and suboptimal hybridization structures, one per line. Each line contains the structure in dot-bracket format with a "&" separating the two strands, the range in both sequences, and the energy in kcal/mol.
+- For FASTA input: PostScript structure plots bundled in a tar file
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnasubopt.xml b/tools/rna_tools/vienna_rna/rnasubopt.xml
index f583bade34..079ecabc7c 100644
--- a/tools/rna_tools/vienna_rna/rnasubopt.xml
+++ b/tools/rna_tools/vienna_rna/rnasubopt.xml
@@ -1,24 +1,26 @@
-<tool id="viennarna_rnasubopt" name="@EXECUTABLE@" version="@VERSION@.0">
-    <description>Calculates suboptimal secondary structures of RNAs</description>
+<tool id="viennarna_rnasubopt" name="RNAsubopt" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>Calculate suboptimal secondary structures of RNAs</description>
     <macros>
         <token name="@EXECUTABLE@">RNAsubopt</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAsubopt < '$input' > '$output'
     -T$temperature
     --dangles=$dangling
     #if $methodOption.methodSelector == "range"
-        --deltaEnergy=$methodOption.deltaenergy
+        #if $methodOption.deltaenergy
+            --deltaEnergy=$methodOption.deltaenergy
+        #end if
     #else
         --stochBT=$methodOption.stochastic
     #end if
     #if $outputOption.outputSelector == "yes"
-        --deltaEnergyPost=$deltaenergypost
+        --deltaEnergyPost=$outputOption.deltaenergypost
     #end if
     $sorted
     $dos
@@ -31,7 +33,7 @@
         $advancedOptions.notetra
         $advancedOptions.logml
     #end if
-    #if $constraints.maxBPspan <> -1
+    #if $constraints.maxBPspan != -1
         --maxBPspan=$constraints.maxBPspan
     #end if
     #if str($constraints.constraintLocation.constraintSelector) == "fromFile"
@@ -67,91 +69,81 @@
     #end if
 ]]>
     </command>
-
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param format="fasta" name="input" type="data" label="FASTA file"/>
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="2" selected="true">unpaired bases participate in all dangling ends (2)</option>
             <option value="0">ignore dangling ends (0)</option>
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
-        
-        <param name="sorted" type="boolean" truevalue="--sorted" falsevalue="" checked="false" label="Sort the secondary structures by energy" help="--sorted"/>
-        <param name="dos" type="boolean" truevalue="--dos" falsevalue="" checked="false" label="Calculate the density of states instead of the structure" help="--dos"/>
-        <param name="zuker" type="boolean" truevalue="--zuker" falsevalue="" checked="false" label="Calculate the Zuker suboptimals instead of the structures within a range." help="--zuker"/>
-
+        <param argument="--sorted" name="sorted" type="boolean" truevalue="--sorted" falsevalue="" checked="false" label="Sort the secondary structures by energy"/>
+        <param argument="--dos" name="dos" type="boolean" truevalue="--dos" falsevalue="" checked="false" label="Calculate the density of states instead of the structure"/>
+        <param argument="--zuker" name="zuker" type="boolean" truevalue="--zuker" falsevalue="" checked="false" label="Calculate the Zuker suboptimals instead of the structures within a range"/>
         <conditional name="methodOption">
-            <param name="methodSelector" type="select" label="select algorithm">
-                <option value="range" selected="true">energy range</option>
-                <option value="stochastic">choose stochastically</option>
+            <param name="methodSelector" type="select" label="Select algorithm">
+                <option value="range" selected="true">Energy range</option>
+                <option value="stochastic">Choose stochastically</option>
             </param>
             <when value="stochastic">
-                <param name="stochastic"  type="integer" value="1" label="Calculate this number of suboptimal structures chosen stochastically" help="--stochBT"/>
+                <param argument="--stochBT" name="stochastic" type="integer" value="1" label="Calculate this number of suboptimal structures chosen stochastically"/>
             </when>
             <when value="range">
-                <param name="deltaenergy" type="float" optional="true" label="Range of energy for the suboptimal structures." help="--deltaEnergy"/>
+                <param argument="--deltaEnergy" name="deltaenergy" type="float" optional="true" label="Range of energy for the suboptimal structures"/>
             </when>
         </conditional>
-
         <conditional name="outputOption">
-            <param name="outputSelector" type="select" label="select output restriction">
-                <option value="no" selected="true">no restriction</option>
-                <option value="yes">restricted output</option>
+            <param name="outputSelector" type="select" label="Select output restriction">
+                <option value="no" selected="true">No restriction</option>
+                <option value="yes">Restricted output</option>
             </param>
             <when value="no"/>
             <when value="yes">
-                <param name="deltaenergypost" type="float" value="0.0" label="Print only those structures that have a smaller difference in energy than the mfe." help="--deltaEnergyPost"/>
+                <param argument="--deltaEnergyPost" name="deltaenergypost" type="float" value="0.0" label="Print only structures with smaller difference in energy than the mfe"/>
             </when>
         </conditional>
-
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA structure" help="--circ"/>
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>                
-                <param name="logml" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Recalculate energies of structures using a logarithmic energy function for multi-loops" help="--logML"/>
-            </when>
-            <when value="basic">
+                <param argument="--circ" name="circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA structure"/>
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
+                <param argument="--logML" name="logml" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Recalculate energies using a logarithmic energy function for multi-loops"/>
             </when>
+            <when value="basic"/>
         </conditional>
-        
         <section name="constraints" title="Structure constraints">
-            <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
+            <param argument="--maxBPspan" name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span"/>
             <conditional name="constraintLocation">
                 <param name="constraintSelector" type="select" label="Constraints">
-                    <!-- <option value="fromInput">The constraints are included in the input file</option> -->
-                    <option value="fromFile">The constraints are in a seperate file</option>
+                    <option value="fromFile">The constraints are in a separate file</option>
                     <option value="none" selected="true">Don't use constraints</option>
                 </param>
-            <!--	<when value="fromInput"></when> -->
-                <when value="none"></when>
+                <when value="none"/>
                 <when value="fromFile">
-                    <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/>
-                    <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from the structure constraint" />
-                    <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint" />
+                    <param argument="--constraint" name="constraintsFile" type="data" format="txt" label="Constraints file"/>
+                    <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from the structure constraint"/>
+                    <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pairs given by round brackets () in structure constraint"/>
                 </when>
             </conditional>
-            
-          <conditional name="shapeOption">
+            <conditional name="shapeOption">
                 <param name="shapeSelector" type="select" label="Shape reactivity data">
                     <option value="isUsed">Use shape reactivity data</option>
                     <option value="notUsed" selected="true">Don't use shape reactivity data</option>
                 </param>
-                <when value ="isUsed">
-                    <param type="data" name="shapeFile" format="txt" label="Shape file" argument="--shape"/>
+                <when value="isUsed">
+                    <param argument="--shape" name="shapeFile" type="data" format="txt" label="Shape file"/>
                     <conditional name="shapeMethod">
-                        <param name="methodSelector" type="select" label="Shape reactivity data" argument="--shapeMethod">
+                        <param argument="--shapeMethod" name="methodSelector" type="select" label="Shape reactivity data conversion method">
                             <option value="D" selected="true">D: Convert by using a linear equation according to Deigan et al 2009</option>
-                            <option value="Z">Z: Convert SHAPE reactivities to pseudo energies according to Zarringhalam et al 2012.</option>
+                            <option value="Z">Z: Convert SHAPE reactivities to pseudo energies according to Zarringhalam et al 2012</option>
                             <option value="W">W: Apply a given vector of perturbation energies to unpaired nucleotides according to Washietl et al 2012</option>
                         </param>
                         <when value="D">
@@ -161,20 +153,18 @@
                         <when value="Z">
                             <param name="b" type="float" value="-0.6" label="Intercept"/>
                             <conditional name="shapeConversion">
-                                <param name="conversionSelector" type="select" label="shape reactivity data" argument="--shapeConversion">
+                                <param argument="--shapeConversion" name="conversionSelector" type="select" label="Shape reactivity conversion">
                                     <option value="M">M: Use linear mapping according to Zarringhalam et al</option>
-                                    <option value="C">C: Use a cutoff−approach to divide into paired and unpaired nucleotides</option>
-                                    <option value="S">S: Skip the normalizing step since the input data already represents probabilities for being unpaired rather than raw reactivity values</option>
+                                    <option value="C">C: Use a cutoff-approach to divide into paired and unpaired nucleotides</option>
+                                    <option value="S">S: Skip the normalizing step</option>
                                     <option value="L">L: Use a linear model to convert the reactivity into a probability for being unpaired</option>
                                     <option value="O" selected="true">O: Use a linear model to convert the log of the reactivity into a probability for being unpaired</option>
                                 </param>
-                                <when value="M">
-                                </when>
+                                <when value="M"/>
                                 <when value="C">
                                     <param name="c" type="float" value="0.25" label="Cutoff"/>
                                 </when>
-                                <when value="S">
-                                </when>
+                                <when value="S"/>
                                 <when value="L">
                                     <param name="s" type="float" value="0.68" label="Slope"/>
                                     <param name="i" type="float" value="0.2" label="Intercept"/>
@@ -185,51 +175,41 @@
                                 </when>
                             </conditional>
                         </when>
-                        <when value="W">
-                        </when>
+                        <when value="W"/>
                     </conditional>
                 </when>
-                <when value="notUsed">
-                </when>
+                <when value="notUsed"/>
             </conditional>
-    </section>
+        </section>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="input" value="rnasubopt_input1.fa"/>
             <output name="output" file="rnasubopt_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNAsubopt**
 
-In the default -e mode RNAsubopt calculates all suboptimal secondary structures within a user defined energy range above the minimum free energy (mfe). It prints the suboptimal structures in dot-bracket notation followed by the energy in kcal/mol to stdout. Be careful, the number of structures returned grows exponentially with both sequence length and energy range.
-
-Alternatively, when used with the -p option, RNAsubopt produces Boltzmann weighted samples of secondary structures.
+In the default -e mode RNAsubopt calculates all suboptimal secondary structures within a user-defined energy range above the minimum free energy (mfe). It prints the suboptimal structures in dot-bracket notation followed by the energy in kcal/mol. Be careful — the number of structures returned grows exponentially with both sequence length and energy range.
 
+Alternatively, when used with the -p option, RNAsubopt produces Boltzmann-weighted samples of secondary structures.
 
 -----
 
 **Input format**
 
-RNAsubopt requires one input file
-
-- fasta file
+RNAsubopt requires one FASTA file.
 
-
-------
+-----
 
 **Outputs**
 
-- secondary structure in dot-bracket format
-
-
+- Secondary structures in dot-bracket format with energies
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/rnaup.xml b/tools/rna_tools/vienna_rna/rnaup.xml
index 44cc87006b..36ae9e9af9 100644
--- a/tools/rna_tools/vienna_rna/rnaup.xml
+++ b/tools/rna_tools/vienna_rna/rnaup.xml
@@ -1,14 +1,14 @@
-<tool id="viennarna_rnaup" name="@EXECUTABLE@" version="@VERSION@.0">
+<tool id="viennarna_rnaup" name="RNAup" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Calculate the thermodynamics of RNA-RNA interactions</description>
     <macros>
         <token name="@EXECUTABLE@">RNAup</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <expand macro="version_command" />
-    <command>
-<![CDATA[
+    <expand macro="xrefs"/>
+    <expand macro="creator"/>
+    <expand macro="requirements"/>
+    <expand macro="version_command"/>
+    <command detect_errors="aggressive"><![CDATA[
     RNAup < '$input' > '$output'
     -T$temperature
     --dangles=$dangling
@@ -32,90 +32,75 @@
     && tar -cf '$accesibilitiesFile' *.out
 ]]>
     </command>
-
     <inputs>
-        <param format="fasta" name="input" type="data" label="Fasta file"/>
-        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
-        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+        <param format="fasta" name="input" type="data" label="FASTA file"/>
+        <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
+        <param name="dangling" type="select" label="How to treat dangling end energies" help="-d">
             <option value="2" selected="true">unpaired bases participate in all dangling ends (2)</option>
             <option value="0">ignore dangling ends (0)</option>
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
-        <param name="constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Constraints for the secondary structure" help="--constraint"/>
-        <param name="ulength" type="integer" min="0" value="4" label="Length of the unstructured region." help="--ulength"/>
-        <param name="contributions" type="select" multiple="true" display="checkboxes" label="Specify which contributions to the probabilty of being unpaired are listed in the output" argument="--contributions">
-                <option value="S" selected="true">sum of all</option>
-                <option value="H">unpaired within hairpin loop</option>
-                <option value="I">unpaired within interior loop</option>
-                <option value="M">unpaired within multiloop</option>
-                <option value="E">unpaired within exterior loop</option>
-                <validator type="no_options" message="Please select at least one contribution."/>
+        <param argument="--constraint" name="constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Constraints for the secondary structure"/>
+        <param argument="--ulength" name="ulength" type="integer" min="0" value="4" label="Length of the unstructured region"/>
+        <param argument="--contributions" name="contributions" type="select" multiple="true" label="Contributions to the probability of being unpaired">
+            <option value="S" selected="true">S: sum of all</option>
+            <option value="H">H: unpaired within hairpin loop</option>
+            <option value="I">I: unpaired within interior loop</option>
+            <option value="M">M: unpaired within multiloop</option>
+            <option value="E">E: unpaired within exterior loop</option>
+            <validator type="no_options" message="Please select at least one contribution."/>
         </param>
-        <param name="window" type="integer" min="0" value="25" label="Maximal length of the region of interaction." help="--window"/>
-        <param name="includeboth" type="boolean" truevalue="--include_both" falsevalue="" checked="false" label="Include the probability of unpaired regions in both RNAs" help="--include_both"/>
-        <param name="interactionpairwise" type="boolean" truevalue="--interaction_pairwise" falsevalue="" checked="false" label="Activate pairwise interaction mode" help="--interaction_pairwise"/>
-        <param name="interactionfirst" type="boolean" truevalue="--interaction_first" falsevalue="" checked="false" label="Activate pairwise interaction mode, compare always with the first sequence" help="--interaction_first"/>
-        <param name="extendfive" type="integer" min="0" value="0" label="Extend the region of interaction in the target to some residues on the 5' side." help="--extend5"/>
-        <param name="extendthree" type="integer" min="0" value="0" label="Extend the region of interaction in the target to some residues on the 3' side." help="--extend3"/>
+        <param argument="--window" name="window" type="integer" min="0" value="25" label="Maximal length of the region of interaction"/>
+        <param argument="--include_both" name="includeboth" type="boolean" truevalue="--include_both" falsevalue="" checked="false" label="Include the probability of unpaired regions in both RNAs"/>
+        <param argument="--interaction_pairwise" name="interactionpairwise" type="boolean" truevalue="--interaction_pairwise" falsevalue="" checked="false" label="Activate pairwise interaction mode"/>
+        <param argument="--interaction_first" name="interactionfirst" type="boolean" truevalue="--interaction_first" falsevalue="" checked="false" label="Activate pairwise interaction mode, compare always with the first sequence"/>
+        <param argument="--extend5" name="extendfive" type="integer" min="0" value="0" label="Extend the region of interaction on the 5' side"/>
+        <param argument="--extend3" name="extendthree" type="integer" min="0" value="0" label="Extend the region of interaction on the 3' side"/>
         <conditional name="advancedOptions">
-            <param name="advancedSelector" type="select" label="advanced options">
-                <option value="basic">basic Options</option>
-                <option value="advanced">advanced Options</option>
+            <param name="advancedSelector" type="select" label="Advanced options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param name="pfscale" type="float" value="1.07" label="Use scale*mfe as an estimate for the ensemble free energy " help="--pfScale"/>
-                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
-                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
-                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
-                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
-                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>
-            </when>
-            <when value="basic">
+                <param argument="--pfScale" name="pfscale" type="float" value="1.07" label="Use scale*mfe as an estimate for the ensemble free energy"/>
+                <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
+                <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
+                <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
+                <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
+                <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
             </when>
+            <when value="basic"/>
         </conditional>
     </inputs>
     <outputs>
-        <data format="txt" name="output"/>
-        <data format="tar" name="accesibilitiesFile"/>
+        <data format="txt" name="output" label="${tool.name} on ${on_string}"/>
+        <data format="tar" name="accesibilitiesFile" label="${tool.name} accessibilities on ${on_string}"/>
     </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="2">
             <param name="input" value="rnaup_input1.fa"/>
             <output name="output" file="rnaup_result1.txt"/>
         </test>
     </tests>
-    <help>
-<![CDATA[
-
+    <help format="markdown"><![CDATA[
 **RNAup**
 
-RNAup calculates the thermodynamics of RNA−RNA interactions, by decomposing the binding into two stages. (1) First the probability that a potential binding sites remains unpaired (equivalent to the free energy needed to open the site) is computed. (2) Then this accessibility is combined with the interaction energy to obtain the total binding energy. All calculations are done by computing partition functions over all possible conformations.
-
-RNAup provides two different modes: By default RNAup computes accessibilities, in terms of the free energies needed to open a region (default length 4). It prints the region of highest accessibility and its opening energy to stdout, opening energies for all other regions are written to a file.
-
-In interaction mode the interaction between two RNAs is calculated. It is invoked if the input consists of two sequences concatenated with an "&". RNAup assumes that the longer RNA is a structured target sequence while the shorter one is an unstructured small RNA. Additionally, for every position along the target sequence the best free energy of binding for an interaction that includes this position is written to the the output file. Output to stdout consists of the location and free energy, dG, for the optimal region of interaction. The binding energy dG is also split into its components the interaction energy dGint and the opening energy dGu_l (and possibly dGu_s for the shorter sequence).
-In addition we print the optimal interaction structure as computed by RNAduplex for this region. Note that it can happen that the RNAduplex computed optimal interaction does not coincide with the optimal RNAup region. If the two predictions don’t match the structure string is replaced by a run of ".".
+Calculates the thermodynamics of RNA-RNA interactions by decomposing the binding into two stages. (1) First the probability that a potential binding site remains unpaired (equivalent to the free energy needed to open the site) is computed. (2) Then this accessibility is combined with the interaction energy to obtain the total binding energy. All calculations are done by computing partition functions over all possible conformations.
 
 -----
 
 **Input format**
 
-RNAup requires one input file
+RNAup requires one FASTA file. For interaction mode, concatenate query and target sequences with an '&', or use the --interaction-pairwise or --interaction-first flags.
 
-- Fasta file
-
-For the interaction mode, the sequences of the query and target have to be concatenated by an '&', or the --interaction-pairwise or --interaction-first flags have to be set.
-
-------
+-----
 
 **Outputs**
 
-- most accesible region of each sequence
-- accesibilties of each sequence is written in a file and these files are bundled together in a tar file
-
-
+- Most accessible region of each sequence
+- Accessibility profiles in a tar file
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps
index 7330968a048417ef6184e4ad10e304afd255c2c9..eb60f267b7e978ed914472451eaaf28af096e0f2 100644
GIT binary patch
literal 14986
zcmds;S#KOil7Qd&D{>x)kpPjZ`w(UxD9M%w7<h$|HT$43gkpDzEUVc?_d!uB_`mNL
z5t(%~xw5skvE!vgvN|d%GVX|qOdkK~<*SpkWq;nDq^FVl>gB7i<>Ki0_}QjycKzmw
z`)Aj#*Udk^Jv&KG%hM#>>iYHbX4gJ(|Jg3x+4aUHwTsIq3I8jXL`ebScinCU2G6?Z
z{m#8y^*f+X`~7;^tuLPTw@+NezcS)Gkwu^Pi~Uu*-hJJ#ciSiKn|5{6?z%<8t(VP3
z3n=FDtM&3(e<gU^qoZT@a?@XInk&~|?_dg?lV#%M#&?(9*1hXity@5^>DF7fyKLR|
z$9=PD-KOt%Ti3sH*PH&lIqz28u4}ihTPxDLescwh&bc2PPi%G%t{-%det7uM?a%w$
zqoc>qUoN}F&c*Pq7t8kD(UAw9w-?<S4vwG71^li03m)O;cG1AjyJod*ojmb)b$!K(
zaeETwj{62gvCTibZFdf?d*gPSeS7fZ`w>x<ymf+TbnpK3*s{_mm!OU7kM3f}b$h$G
zbU(QcCG^)^oOkP`QNC(!N8HutaZw1k$J_3|T6gO{I{AF!mYe3oR<9RWs@>ow{o36=
z`gjDd33^_(w=O!(-PL~Ow)=CS!`Cr%PW~!)1zEYg?+Lx(j#+X<PTfh2ZC5L|++Vv*
zyV&6YtD~uGVnO#wC=V9VPX^HEn&r}&X_noMi;V?gQiw)Q6(TB&RC_{7v?#w*ux0sy
z@m0GXACH|-77v;-v>F(iKK%<GR2{cJiuQ5iZoPBc_Q!p@UbL=R_3I0Mu3YA}-Ll;t
zy>V}%)6$(przw1Y4}<zyV6v1j7AaIQ1SA6UA#*47J$I%LD#G`s)QfF%(~9`QL$g%Z
z+Vne;1y0<ow=1snc7&>AnOGO{CNKqG^#p#eSffa4?$}+B62zfy8dWmkdD(wZ)Snz-
zD_0krc1!Y-WfX=QW(pU*U2M9gtQpu9SCqx4JVvJx%(c5!w{Aal%iSgT!m&hZbXqIl
zi<^!tU?y&FuN|fk(r$a*EXZ;^Ayi?TAmRgG@>#wUNgX$K>6*=^`RE#D+lXa$o8_0y
zR#yHAJ7Y4ecUpeW4`og6sq?ku6p%b8!sUE9TRU=7)v7GW7E}#ah9);u-QohC<l%#Q
ze}*V(3Z%BXP5*u{094<=vgpzagKBZixoVF!X*eEj$V1!qy4gq#A}PNkl7HNHBoQbr
z_L~hUMbqx%b+>rGb??{xhahk;s8~V_?Sw5&?2>~PBxCgvxQWH}+TG>$e1!UEK6JZF
zeUNIv3J}m*5m5leg#12a-Z^DOZ+|kM*6Uzx(voS=`@E)@QDHMh20QSKYWdECru*^f
zLE96D7d~f!pb5&$x9pmWeytHiI>XwNB>*U8F@)K0AT!NcqFXIK>S!~gJb$^9(mylH
zv9mhh?AETm-Kl;a4^^I8y<WbfR7*T*rPL2tNPa7FT1dM<&CvYd!aAa3m?hjaN;Tyq
z8eHp^NOc>J?=yww>ZvH#8}YUFS>JD#TNOu~BlQsk=a=o`z58&9ue2NYp>-b`xZL$D
zvAtdqw_bX;q;d~dpO$eo7@13N`oP3L4+;PIhRnU#?MYaaXnLk?f7OmuofDd``u&Cs
zA4qBfnW|rJOd~=(0lV`k^z_;7+aDaw5pr*dq(^{N`Qix|I6hsG<|E}+p1wmKQ3A3@
zlI%2=M4yd@x)@Tk@+RiWhdM2RK#7@D?HuK62_M0NL{Gw6;;iy1)t}Nk8cm-`)o(yk
zpq1On<(S;3=HKHwQbIeLJ?RFW0H6^v$$h1PXr`S~Cj&D&t*ntDE9X{9PwQOZY0B+T
z)>*^5nj`59xoDn)jvdKN_*m|-vUIEq@yl*a-K3xGH<r*KD|(#wJ6X`&N<7W{%;H<r
z7QQ1_xs$|H?3ELG8zCuZ3Krl<e>BD&Bx7W3d_sKsJo1@eaQV}~=>ab@K4ghG2ZK@%
z*@2$BmjhXhTH<|kvFfG7;O^QXPLk!!H(o!#>UZ6{;2(Sc8Ct*EJ)+YBGJ_nyt#kZ#
z$_%B!ih?)hFVo)YKzrfyzrFSjeM)0(^gnA^r*5wZQ;$W&U!l1DH*>GEkH3Z5$Vqkm
z|K088+FSi$wD*7Rc7L0>-FvrkdjtIeTyG4@p@GmOIE_jT)8Y15+)z9c4mb3<p_mRC
zdXiJ`5DiF>xi{{=EN|Ym!|D%Xhx^jxT(f4WdsG;@KvA^XBLME;7PF2qDBqPd34Z+Y
z>#ZPfINEUQ#PDgq+x1sEYq@ndZmkXVtLZI$+mzwX*rg`g44NArj(z6jzhj&vO~%jD
zmUkM{;4h*3_x7EP?_^5$b4-tf2Yt$D>dxq7)X6`(i_2e1{n+i9dd{YV@&+Yu=%zE%
zl~~&Pd;b#fGc1@{zIpX@(B7qE?s$)V1ZT3`&+-#EF}?;5o^<Q(XL!S=zXxNZo&GmW
zi9>vztAOz(${Kkp!aK+pC`$e4w`XeZQD4TGjy6Kf6Vdn0DQKngdnXkU*@?O7SYPB-
z$|odfNtr*KSBL_~NriKu>9}J0G7>U|@}>#n%NY}|j!z38V<Erl`?U>Kek=Yg@q8(R
z>PM(f6sD{yqn}ru9|43Z55s6`fDD|y4&4a&AGPT-*_W~#G#PTm@5?enoSx~x4p&-s
z?>_2qKnFD>ymrOZV833;r1E3G*V!8*t7a#k{>+BgvS&W_Cw8vJ5t6(pzj2Ru{j~ty
z;}xmFuFkdC+4V+}yk1VWot~4opR$i)6oO+~ITX)ykLNJ;h69+7t^=rA;_gb49pH6N
z)hE~kXvkj&U|UY;9NZYP&%vr1W~!mE>JWGX1%=FoQ_!Jo3N$CPRgPt{%vjnsCD~Ev
z7BW#}4oQ`isZX=NWmB@*eAIbQv#~KCy9?b7A<Xc}Ti#pm5#eIidqh2zRz*zq$jK;u
zupnESuUgq0V&ErhJnj2c+YF@SiLmh~&&g+HT$pUwyk*T+%J@=Pm0eYOEu5@l8xh8L
zGB{j{Cw*Yg4VQE`wu^Z*sO#T)xGHH`ME-pStc;CyKMcK-W$cRyaL;DO_PW<CaZ{e(
z3R26hdSZ#ZywR;Z)h%Up>zX&6?A6)Vz0+C$Dk<Y!YZh&!9TI++K??;z<$Itf(_)!H
zvR}L1HH-I8n2R<{NBK9yQE>uKk6d@!p3WI_laZb071E5J^`A}34K6H<)l#O*0tvW{
zl0Bq-OdY#3L3iucypsXyLULi?&-NWA{LkMY%Fwll19+d;_F8zEDoZ!`fQ6C&PIo#a
zL6BbEyZw40#}M56RyVqX)b2B@J?B|naTw`OxV&qN)6-M0!iic;y0^l{+ry<v8F%=V
z=x%S@#hzW+L*8ers}3TipqKah+BnQt93ea*B0B@eY~V=|r$TA^xM?<B!}*5o1W$A&
zI|!p6@M&^?GP@0GJ@nI{8`I3>*<+WS%1m8d!gg4Eu)TTzy$;o5_m{uA_wFxlJ$X!=
zkdi(Ik>8L*p<xdi;U*7=xu#*$5jYa7tTMw2v*RF$1)*OmakD-B^A#~D??|!_y8F<d
zu=BmwozU^=;FW^)S$j@HQluN+AjI#*6Q!sRj(@MU<?c+F=}!OX3POEoxyPBnfpf@6
zejZ*kRpbY%fH~cooo=5@weSUc_$8W<X5ovKai0&cp*GFff#qW>37VsP+9xo>9+B+z
zcw-*ud#Z8vawdCcoWin=9Zq`qt2-K3oolGw6H>E1lECL=b7TY!M=M5<>PljG!Y?w)
z2x1x)W9AS0f=0qWrTeo2@fU_PY2ED**h`uZJy;dCfyIv=oUQv+w|%>4HvQYh<>vMJ
z?Tf#sS(-%U>29-b(zj=;=Iq6@hfFo}%+}-K$jm4A;9o~C_&Pg#{Th_l&(64d@q%kU
z$!EUh2Eb>4&h*wZdEoVHzF$0h1_sw)K0Eu@(L?yRLtgZ2pExhzkLLI&pULB%e)ZyS
z-%dL{zXN+Tbmwo5ta0SfSZLEn(Ae?05jeDcBkb6H_3iV!%g8~xui0T_+xgMpev4*(
z)5sn1L0>-QQfn39;HKmDq}zVn?%JzI>a}(Z#!hmW<VRod4*ePOM}A@3t`GbT>Lrfk
zgrP2fB>ZwGAj!!bh3SQt?A}J(Js{aOH%+&aGWAd&k`yVF_~jlfID&|9+lSI4ZD`3j
z8qjiAKS?9ZWN^9JU#~dkCQnRn*?z<wuuXUkJkmLDcp<oMx{cH?e^T+IA;qqY+0TjM
zI8MtViS2MA&_s86sv@rPI5lX(!3o1nvN|j40V)*gx|SFzMyODTk~*!TG)fFNb=;TL
zilnTne1Iz5x~_`6teJ=C0m;;J28FCHQ_mStr5mSFmPG-YxuR0KdCqoz=_vq})!?is
zqJ-^rrJH#vq9Tu?yeJ2#=^>4ZG*2Ug=8pTqZy8rv6{G+vtHEhnr-&VJy>^mV#PhNh
zaz+aZQCd`KoEC;#xJ>CrWd-G8fa+>>5!ZEDrJmm+$QBh@TqT)NpxIPSMrmE7Mdm4#
zE-~#CMNyZ*7C`01SA=ABo?vg)1JFWci!e|bRRNmi#&4SBY38M1Ca$<ql~z?ct_J6v
zTd3+Z&*GrT%EfAnC_^=A?m6Q`uj)5T^HSuq)qpC$Q61$mq6|>uH_hUtt~?LmDi3*z
zKh(kUmCLdqTbvhOHlQX&otJsV2|Se;s7X=eVj?dwP~|tv5;V`bA&;xF!B&!BBQJ#<
zP}bG*sKlP0LhWswiJw-Lr%-zvXE_m+1Wnf7qoSgY$~Z{Ds^%tXOkm}~c?2wSAZ`*@
zWrz&G-hFVY44#c;z{oFl&eI}+JrCxLnhBU!6=Hi)c*;B|l~82O0o%I}5+=m%2o^mP
zN-4?<J_M0WO_j!FmEnp5w&@>@)Fpm2g3SP|nWCuy%$Y3XyGA1K_i^I+M*n$T=7AHy
z=J`P5oFjm0FR;zQ;)qx$B1W(<2;T{A8ms^|mn@0CYcfd?9<X{7d{=cIk3@2F={$?-
zBse5#(G(jOc~xh@p9E|S)^SqBA;|$&#llI9AtppJH5%<j9OWSl!8XNaSw+y|btYx%
zFqEna_z+w$YVK3kMV1sH5&;u_hMg5ez9*6!HnCNvc@#1Vr;c(98o0<wOddOAFbV;|
z2(!jX;c$Ow=j5*>9>8Q3%cF#US(6bBJ0u%2O<k6Qs!ErtIC+xP#A$FJz&^R<Xr&HI
zl7%c=WaRT0-3Qv}SftFzL|EB_$roOnw9Hd7pkY^zB&>XwS)L352-r-FUzRyuVAzDV
z5y=vKZ4jsSMB*wf(ku@Q67t@WsgCGyAcFI%8Bzod)d`ECdI4kLq6j4iaB4n?OBG3|
z$O2YQ;<_L(Ljo1BsVYbM6dNkvfHMzHBedcfgjj0fS{7uV5K;mj{F^uq*ojM3v57<o
z#64}mMx-XrsH+~FdTc_c%+g>T^lrI|z=rXV;*lJBVg~#tOGCl~Y}i?xm06vKW+Hc}
z$FQkZ1K+u`*rB*4d4cXtc)+TvlB}ChphvJ;o&-xJ4CR%4XbzD?MVyp_btuugB$WaS
zS3&qtxw9;zjtxZcSX~k#7=h3=PJ$ytB+G}?OCV}+*R`yf5&{9+_)c<?dJ+<~U@PA#
zE)~^mL>M+6tA2t*WGTsD0BewtX6ho!Lg~Xwme~^8Jp3x?BoxXd%Tkh_4?zA9M-@x*
zu45XiKpU`H9=E6Wi2@P879?q0P%}IcEM|(O_(>u6L;$N|>GtTr%8=Ov>|3HN%IM-u
z9Gt|vJ%&ul_aj*R8wSe)hx66}+dBmP2no`=rht`i`~))uhY+x(M*=FzLygDhEh!aM
zM4J)vpnx@`FuLd^a1tsBv`YdlND0_<f|rmA1DGHYDPu|$?KVQIEiqn5c>EO;4eS68
z{+*{)Ui+j3w(oh!Yt>M^@CJ+G7+jKOSQ3x5t^l{EQhB3+YHbe!VqmU~6KttwNN6I`
ztn@^%n5hbfO)!pc$za3!Zo;@ECwn4*trf<*`3hczLVO;C>nIPI4RE1phChVLQtF9u
zB4F=TS%t@XRSDSqL|SAVZp79UM%PLaoGfWC98sB3)P^PLseP4-Dw^j&8?Y@&`HSdt
zJZ-?bWLd`4%-~fh#0y_kB`-dKlhRo?gE%!ErMD$or6<vBUsicWrB!_kSbeZU*YcL)
z!Ii^Mf?bishDw5!jFY&gj1Yq!o2F9uCZvcdT3!RAY~L)@SS`xE`v6u>crD_cCgDlt
z1ZjP<!0Gse7lHvCtb?Bntp(VHgp?4G^yvMBLhKcrRRvz<#SyTW80?b9Vv22Xnd5AD
zieHkqM6nK}$%HjslQ9U`>U>GRHN0*hma2;8pSG7g<FWA*$=@k8K<wk)9udtt0<L*!
zG3@ZZ%NrqIb|!<jUFBj5<Ly(3)>Bw`%bdbkT)c6H=e=kK^VXlihNgc?5Z!3AFvq0l
zRU^zWL!UVX4i#qxBn7BdX26j8r@$d+&w!+6&B0S3U5B~i6gYU?3>Z9U1`Lie0|tMX
W0_9-CHGj}~)UKB@%lnV7kNz7ntHgf*

delta 673
zcmYjPPiqrF6la@OWn#6qP*6O)3h6&cvb!`%T|C$}f(OweQap$_$-HcaZf4@{Y*Q)X
zr7DPr#yRx^_yHuJ!h?q%1VQ`+9#r%L_;!uxFfhOOdw=Hl-ps4?*Y%@I!-w;awqoQ)
z#{uj}REpody;1fne#LWHsg(PqR!wd&fO{!I6Wicjr5&vKL2Vs;*K1JVrcRZRD%{lj
z0o3c@dmhxhb%Orzb>rNfzM(2f0IWoN_+@F@bP-xSLFjWC+k#WCQV|TL+KzRkLso5W
z3)wc{xh~{DV26#lRu*S>omIOv@y`C7cw-L>!C6)nF&`xO7!KIzeWC0W|1e=J#lh(E
zRP3y_(>O+D@_N;FYWi9#1G`EO6eR(zzofl?`pN85kR4*(N(~f-Akx15#^#?fRDxQ*
zp~P70|FT#~V1x!KW8Xj|6@t+aq5+Ztx&ua<2$|n-X*M<J={+QW^(ICHWSc`rD$&s-
z%Ugq_%_Gc>1WkS}Zz%h5ad8Tgt{zxt>80E7Y1nlzF;_`M&%}tRLobaWLIoahA!vYm
znfkn*?JZZXjVHyj)-uPx>=I-?%HW|^JfaAfbfC#P8AxHe%ub$JuwR|Boh)9lCv(fT
zReWGSPd~TE=NHI6B>cjDnt>c2U3i<HA7;OgPUdbor)WOhaNAtjxkxa(D*Fl98?nsF
K!RUD9$INf1Uf*#5

diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps
index 11236f80398249bbb85247624f73c0d214c65eab..beaa6e77f87177ae7a8a4f41739e6f5b73c5b4ce 100644
GIT binary patch
delta 1428
zcmc&z-D=c86sCfdrqW&r-iYws1Qc|W4cgS+)t_GahoDf4Of$3Dsk1X_lI^xGOYXe3
z><jn^;=Y53x4wb+8iHqLH`~^xw>l)7;rx8xcg~*kJ@^oR3~tA*$n*V&xnQL<`VlL|
z23`q{%`8WBAMJP}qGugZ7_A+@Sz8VfA`abq{3*VUXSqpp)`Q7xezAc&Jc8%>czOJ5
z?{4to$!4ZZi8iHhnUvt7<9W4pSEN!?u>Zhb2uhjMn^X&57sp#mw<-W53_bd|6G-B=
z`L!W2CO_r3<{*Q!N~B^+RtGyT1Iv>F7kCvIl+bC}bu^ZLeiU(w{lD0(*Y{DBOmmiV
zWJc<;)oOv~Y=A=cG9{p-7IVopUPf?{)kp~<KVU?y46_KCODK(p@#^yBnTFGCs3C~h
z@j+@RW3o9fl}KfpzUI!3L|Be<5`sjT<lR6Pg37+v*e`(iPr|}hI6X+qhE7;vjOub&
z4Rw(&eNIJFWv76u#tsou1CZ<pRh(`02n|M>BZ)Q`=VzvAgpSFXQVw}UzczL9WhuBc
z{<*w2d3&X|Pz3|YX*!07J$8u09(BIx?~br5sn^rV47x(5U24yf4LNEGX@|59D08L@
zMf*lfYwICR%X?w%PL@0X?`J3yrmWxjh`J(fBE(ch%}+vz%GzyiM0<8X{{h|W%$Xz`
zF}v2fNZ^I3Cj#dMuF~%M{$tH&t2%zYa${jQE?1u49J%@fS|1Eii2c6M3C;d=o8|x=
zZ}M&B$71ESaNFD7`9Dwf4~TcB4au0y3s9+T#1WMnA#U%CKVSQOwdk5b#!}%4&23ko
HZh3zIrH+W!

delta 437
zcmY*Vu};EJ6isy?J_8X)6O*%aU_jbN3N|h(Itn3fPLK8h)kj~`z6wYhHzx;4S69EF
z|KQ;2e>nL8wiQfBZt`x<x#zxn&U5Rt@!F^xN4iE-^&((Yy29&F$t>JN3>{`eKgr5E
zHmqhFhNiccw`RpOVdxr~dK;!`EZ<t?uAeJI3q*xne&6Y;dd^0!*9!y}Bhu(!pZQ!!
z=$Zz{wIv)jBx`VxPo^)*M@fm3{!Z<5VG9vpLAjs~eBpz;9+M)*Pz03o7=Q{Vpi_uQ
z<{W4Uis@Kzmj3LTTS={Qzt=LdD^19NdLhp|rOS%1JY}efNyHJlk1V_80Z!y2v?*r<
zf8cE5dI+NdW)nIq8lxC26!SGX-yk#X|3@Uo!1bKMBlDar+Dp$_B~jimom8raNxj<J
h&f-Ylt6!y*9_%ZJD#Edt!j&X{eL7-fwWoVUegSmejD`RJ

diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps
index 31790d11fe4a82bedc0ac42fe2ad455f77d87807..506161269d2306378863a5074a204e613399afbf 100644
GIT binary patch
literal 18078
zcmds<+j1Pok%sT_6y*zqr3e!2^Fd)>@E}o+aCjM(>Aj#8jNwcZ9CJ7g%?v<t6?*sm
zGPAO}XMm-|wH#|NC;&a#)md42_%kc3q4VE7`|ke3)%a?-UtVP4>u2A6BNu1q=Z|;8
z;xO*M3V&S>+wJ1de|mVoxM(j5zqKB>PZo#atMH%0Dm=W}g`y96`&GezT`01mVc=iZ
zhYcfmHar;*;n`+9Kz%e`Z&&N><)iV#S0UqHoAF)9q)*1>^}Atv_-5Q5_Fsi>ht17!
zST7gcdbYS6Amv<sy<I&X-^sZB+1Yt`wi_>Zi+5qXIv^Bd?yrg<H~#Wwy$`R~n;|UW
zw^(oY;qYb%`yZ|syCLkx@vsl$>u|LjUoBp(H|xWC*oXC22fZG5?_jYG;qQSbc84#n
zzF6P;`<Gva>sRB4v$F?Jo~_o)L&%X`FIL0rv$IHiHC(Q@NO1m0E|70CUh)V(_sa$1
zyk2bfLy#vPY_8rhV?Nx^>cD*?qS(b>*ZcJ=#)cQ+u)7{ketbU-R3-0&3^cyCf5y==
z(~qG*8&@C0<$>$r!}3k|DXdY#c*Vu5^>$^P-z`2&V>h23i$WNCzF+^>5I%&DK|bFP
ztKH)LUayx}YS`f><2HP__wfu_3-r7iK7{O|4)3lvVSoJ!YWg~d&;8%aT^X!W-t~mu
z2<J>W4KBm|9NTU-VRd~KcEj?32W-yfYZD8GABA(Wh<-AHKDSt{f|+Kuz6rUBAVLb$
zET}?6WtnPEScw+pcgbj(J_)`Vw$tNz5YFO3bAdKVp!w6k;6c^#@PlX{H(qZKVL$wE
zJ#3dlSZv1aB|kTz3j6hH*q^-!FS3g^+|Mpb<o+H3^|R1qDiJJGs*VtnESL{fxZmG#
zXa1lL_}-LyxnJB2vV4(Yu~OICjR(L2Cths#8?N+rhN@(mTqlYqFa^IG3H(t<O-oX9
z=iw4a5Qn;1sFDfKH{*L9`coim<?3=b>;W&CMro+wNa3Ql%iVe<bGo?ViZc0J#_S?P
zxZ$u_Z-@8m)!_}}MPiB6?4nn>mp5xrz)U=RxC)p;Scm=9VhPIegm6V{f`|`%$!Ga4
z1Uhc)GAwqx#mBHvv5i?}x0!ym*vrg6VP{N+^)A})`Jtl8J$1eTOkq%zM5H{P&gRa-
zT(!Cu*5;~4DjOy@RNdkNk>%-wdjDvksL5IF54-VgG5}m(AhPH(E(X=&n8&I;SI`JN
zx&Vjv!_{IZIS5dGO(g$ty#_?!w7lN!fE0z@2ix`X?LNHSj_-ZJZcwp=7&?ep3haVG
zOTbut1Zi?{z2Wd?|7xPfXWp+5Z}dU30W-irb45l16ch6MRQM276uteU`LtfUwSgtm
zVDx!~m`PzrigY{hjB5GTgQolG>7?zM!;73pfuH~t*SA_PF2}7#5O9XIXH!5>&SD6&
zVPZ2!EzzweA9b`Nqda+bkko%<mh)hFAlR+L@Zq5Pd62R^xq7>LO{$i7(oCrzu#o)L
z!DS=m0y#tRA^1F^V}vE#G)fh63JtF9K%|CU93PQFv3kCgtDX4T@OT_|tGzBqoTH2p
zgye6A<=gQ74Zbq$!uuh-Um)dSWQzUOhPaKZ4=XZvvidxYtHD4ny%_@&|2$><+Z&L3
zdAJ6!NYT_x`|;f{aScIuem7q4KzL`V05Vs<-k3*(cmj6kQTXYz`<H(Y6i2LkPbA%g
ztjZTpxWw_PiWHAjT6y{wdzRvZ;~+t&DJ4cUN_o+tS!EM*)hSO)Adq5aS-VF0n!+ct
z45B7sE^$`*RO(Nu9gSy1QuP~#DbdpH>~aG4x%sbg9Z8{Uian_YgAm~1NOD(dAet$s
z)X5l`U36B+fXcO{(u=+pdRcPY(>ilRR||kn!lGjgIuC%E$g#S{%2Kf|#V^-e@+S4{
zxHCY5t?2Q%-l<%38}T&rGmCFgn}27a3-=3Caa4}iHo{VdDOrdU|H&A)2ALpJ;p6cc
zapV)fkn*P_>4_{ya>x|N5+tRbiUYrJrvx$?xg`4Lax+Sb!QHh&oPp($Z#;kUZal1C
zyMJ8A&+z((-6OkbV3XGI>pI7;r%X=`mK35ff0_0+C))GR|MJ>9^(l?D$^Wcmox8mb
zn0qWs{09_w{q3>W*~ec)ZD3O0|9^M8W9@DJZM64)?sk7Ta=W)-6RwT)Z{T`UP^JPx
zL2w?G8m8&?l-y7}D@-@^xs*&3LeDVu7E>Ptn>*wF^KkRF9X9_qcDM^Bk2PzSx<iFt
z1&X589!|J5wmGU8UHPG<NQmv1f7}YP!_k6UJBE+O!(n`<y_OH*CTz8!{%(Ftcbn4O
znX1%6i$Qb4)3(ns`@hgmk|N{hdCQ*0H26#S{&9FM?K|m`{hZJf<D^e%P2FmpOgj1V
z`tr>$<$fNn>3SY@31tT*J9N{T=}IhZ^?lp~{EP@@mT$j%l(hFI(09DUJ~C!D-OtM7
zl9*h{gJ;!x_!-%-=|4lT$xi<pp~N9REtQY>9A!;1HNFS=3`MCQ{rW;3d(`I%rmYQ+
zc_R9*J_V&zeP^d41D)ubPWeT)QW22gC29V&Um*&dIu#)>OxqRn&4?q0%BFzv`GSd8
z=NC<kF~?WkUt3e<*OJeG=W_*AKSFh)Fcnn={j}<03&6WPG^5D@(r}JC3=`ph)MiAo
z&lT4-=~(g46`3Z^NO$0XE3MYAKWcM88#Mslu%T;kz1>Ks^5b}|y*FA`i-UanEeBq!
zk^b0kIJufyNU~9W5gr`ID<Osl8=%3iUTLzk>z#nSUe1o4o`BnrI7cxK?wFPi#WTZ$
zW14!y2`xs~2~{m|dnQ2#WIg5@0rrII_;o_I>4eY8jf6fYvuc>BhJ4l(c!`5jju)q-
z)3qtloXlo9m(DV6X*-nUL}9&@jv{?XvZQo<7S|s*lw9mSYQJZ(vo;{73+o#~nC4To
ze6-#@!o{q2k9;bnikR$PkXCxKAV-?t4RSa{!%yaTG>)5LkyyzSe()&I$!8T@gj{fV
z%bbIx@s)@wr>fLiIN6$GL<B!b<8URO^qw;}Tr%9)Ddt&H*S~agRbW|`{Lg8y(l*xf
zF!T<}*cTn(k;9Dr)u>0}ro4C*q?X%^#1go?)1y4qEopTh7BALvR%c&#c4y;OQrfvz
zELuz30pEMj!a;`eo%l(&SbC70*X|FC<=e05i!SJn^6zMjF2`lM7uFZU#j#*v*0PJT
z!kX5z{<BWG(M5zQTS|9XC_Z+fY)^TglgDm#(8G2x@1%jc6fAW4?A&1{|M3o@^{Pc2
zAo{$P*CNYYS$e<+&0GElJ?RjD0A9oE>+MorLkMpNJ?QpThfmD*glBce)Y6|xdD|8j
z7Z*{5Gqu?2UWynmPp1YlZpkarJ$x9J*PP0p%6>Gv>L61NdU>a>P0f5ABaCNE<YeHS
z13XFMWGID?o5gOu;QfaEY@FyyP7o$P;M45>tas~bJ@r%9jcI1~?0G0Iq^GVfVJ9px
z*j~K-UYqK9_}%Zr+wi-vojoQ_NJ^iAC?3e6P(OoaakB@+T=TG56F3s9%yKl!d&j;I
z3&J>65suFEUu}p%*(1q0=;8f%pOf!vJqewjcCVCCpS0&ZBxQAJ2O)kho+wE@IsTp2
zmb*ubnV<Aet{~h~$vyQ1PMkwp^2gzIq>B1P6$qzCv-9JVxfVV{55GhcQY?J7GVbyL
z4%Fs|?INFBN>Gf7uuow68IhdzL}Q-ld#-WLa%N{|yoF^4JG|);uWo5vb*`ayM@Su=
zk+__*!;y)UUago&sw;`%nY^q~S`hQ7n2_Jk1&u{~O3!D75-)7ftaP`Rz@AZj=!;c;
z3@m>1#l!8mS?^yi7rXK0^3Cq~_T|$*mQ`8z*~MYET@)`LZWa%pKK_!fhQ71)AiXm4
zWBB54XV0HLefsd>^XCkC{`etRPoHwlC;7~`+<^ET(nGza4{!_O<HwI5a`QPOA3yxt
z*_X&~FL_a~{mA<Q@ztCd<wxrYkG_8Thd<3Ly?6q9ma6j?XI41!(wLX&6KSgW!bD7E
z-$XkPU;pXJ?P=six^FmP<k<OMa=+zbd$W)`;)5}L%BAKi$nK`o@nqP4+#iN__tb0c
zH5hx7!&ZLw8GGnYus@3v+i|_im()uf$s2|`{h7$i9Umlb<|s`s;>zwUw8IyG?c!#!
z-bkAIQXdkC6i)mKUo3eAk;U!5lp1MANye)I19$b46vA`{SG()04X?S$6Z2bk9&w9o
z9bO|(d|oZs5L_+RJIP=1O~sEkC<kD9ktVB}vM9>V-c8Iyuf(RQE2vJ)E2w$i<Yive
zX(*@F!l16RrsrKJeYuf0A9yVjYTxEfQ`Lzo9J01-tE?=lL~V6!(`I?srr8=Dn^j$#
zS6v#*ea_O`tS{;Ud33gd!)TeT&APJe3Mb~dQoAZ^in2-6B95)9E{l^DAs4oJ(dSvw
zm5D=Pf|abHuH(`Qc}<nsP(xPceN;mcN}a9lyR6SA4qVCDu4}RuZc*G)X3M&)s=Ko4
z6V)uy)>YT>f=V3Q=-8}o^RCR(Y>gSHt?MRl6NgrnUUW^Jm9DZPv?5tuHBHeKjEH<&
zk*saYrbCFxp``gOimckIukt7^ja*$C%dIg_WB^qdpt3Bli#m!6)x<6P63&S&FZ4#0
zbx93nRAg4ew=2_ZrpQ9b7}>-vgDDaf6h$}jZOoV`r|jG44P|J|9dNv+FQVC?s>({7
zsm|*pnX0U=yFTx0Hydh@6}Na<R~1c?K~+}pa8nd`rz*0FzK6b>!fna1k1)uwM3<MY
zbEvAEJTLOBtD-Hdz#>)YS>AKU*_!V$S>E?qR1RZpX%(c#tp-(>)>K(uHFflKT8C;j
zJgn#mPUqVwHLDxc=pk5zCK|r%@-|BxOp&Fi0lg&-GF#8unzm(~Q4Old978l^jn6t&
zW-ExFB5Rt&R~1RT;`}MJsUj^_vKH^>%|+!<#}zk4(?E?nt3wqbqpO?BC9C5qN-#tI
za}K(Sz5sLjjL3_8Ro;RyZV)f7f?6|0d|9^9@Qu7?sTL~Hy7Pr<w&)1V%!8$glC@=>
z5m*sPnt=W#0BSI<a3q0hQCzk~m3b65wu%mS1kc=>P<6Jl?5hkr+bSB~WK+q&tel83
zD*I4F5<)QV+$W*hY*h`>A-N5OX}xZ{3UfLKKwnneWDPDAwa!@On}eJ{b@WM&%M7S%
z;p*@WRlS-JAT78apehG^w<_8?Y6q&Wt&pJTJzAiuym^-wk{Mhw5|7%VuKJSjS8KKb
z-{J+Tq9q1F7^8L}rY34PqA-R$RO3(=g1?b3e{i62QQ}TuXY?JY1~4u025dNA(?eBN
z<O^b2W$2<F^1daLy4Inp9y+okD3@f2dME+3ir8}wB3V&^BmhUWW*2IY&AjXTv^GzV
zWuG^F;;VYdkPFG&tL3jMRA=Bc^2Sy4(W`Ou0z`@{?#+J-oR7rMn{g^xA0rE%Jw6#%
z3{^GBA25K3tSF9+K3SDWn?=cZ9n*rSAl&L?WFd=wx&l1u0S@B<nS`wl2%wSG6WQXv
zAaAv8KaGw_vVwEt-~$t&TbR^1Yv#FL$Wa|tMKX%&5VFNbU1L~JM`+931xty?M)eC>
zM;D@yl+qwahapjx)8ZjZj9~1xC(xo+8C{xyO+}ehMu3G}N%RqS6cSDEi-#<useAga
z&)gYhw5qD8D4s}SQB{;QY8)ybN}AqR3E5UjNkk5tMw|O*)G1Z(K>;8u4v5@UMrKI7
zkyWjO^H6{!awX9sN+mye&Vq>o1ir@xs_)!rkah7nIiSueXF>&GPK5)OI7Q?Q+2n?G
z3w9*3>Kg$YDgy@}LXzAl0t(D@GbT(U0+t9;B*m7d?}DPK%}`<FO<GlOrHtr0z#@^U
zl9hLk*RnMAdU6mc3*LgG6{#wc$zMVy-<P0Unz9bYB+n~MmMU!Wnoe2gWR%I-JOSl3
zep0orlg5}-_;yBA`jn&~of5!eMR=GA2zp!Q?^^P<;}bSDFk@tgXS%bsfe2tZJ!L{e
z1(KMkVsj~tC=lJ2ZP2nDJk3S7t}5Wu{2O;DQaZ)H8r&7umA%9?T6IDR1k!dXiaY+W
zOY~jWEzq7~9{4ieCAA~r9R=)-H?Gs;;3<kBo6%~d#wF5dE%e~s^!Zfb14`!KWP^$_
z-$r9db$j&P<yno|RIx(VxUAZSI@DDq<Onm!mkMNTV3jO8BWhl+B84n5PbEwoQ}9LJ
zc}(zB?|`G1YxulXd|5*Zq$G)>eG|g|40QCeh|xM_fv43usdO5xFq4UA)(!=XHdH4V
zI&2){Qpg%obxl-e9)Ngmtb#xpsR|<RSg+UOmxO#oO-9?!C#%@~0kUbd!8+S1(8sZg
z(GjSTq)p|$kkyu0fYp1-KsQk*)G-uDE_W=0sTN36tz#9VZA!_MU|7Tx$Tnrk?xV@P
z=)lu-J4^j3QIh#`2v-X!O3*6zNMp1iTSKs-Dd!DYftu7xLh>Yl8(FHObn0<7_o^7h
z8K~A4l+{sHUSBqpG<BAEdx6Q$P4+h~AW^JALg-W-dzQ!qvf5JogpBUIskp=;IwGMV
zk49v})V3VK^q%yUnAmd2TRBRJFe9T4dNEH?VJr)hHc&MPYE~5NR7jBw6lkR3-+kLA
z-c(Hz^Id@xO0r9%t<<bK${Ths6IoYD@ZjNI=i!$zF@iI7>sTdZgMy~+@io^8WtNqC
zAUKHZQ&JC!i95<`ip69!$hsVAx2B}lkCH%+`X)x$R!?NFW@M-8itPhQTy;X3otzC%
zGlyVLP*kNm8)SubB%#ki;xXPrR+ynUVM0(&^$po}9Q1WaB(6brgys<7BNKweHX5=R
zO;#!U&53OOE&UIcA5{etTYN*2(^J(ZCboFWEfnSL2N`YkNhhJ>wXTrOPY|#Jts)b!
zN|#g9FUbgqiEN`uQB*lD2{nXku<fbO(r9%bT)SyH>ZOTnuwLhQtnUQDMw6Syk7SK$
z%IGI$)5~ThG6BL=z>acjYTm#sh7?F&vCuTy1jM^bwu8RPSaA>yeMjg-KY@w)H+v?6
z!3z-~$K)khC$%m>HYKyEq~!9#5AU)X0_(6b;Mz>=fQMUBig=#K8{%GEx__x8!U0Wg
zBq;zU*EeMKZ``$&u21Am%v-8sLxg9!L$E80WQwgkwNX4SaZQR-<}m>~+rv?<H*EOO
zrjxC-=%q$xmmA6KJ)$I1Cw4w%Z_6RZ1d>Py$^<3E-4YptNQ?T09Lp9uBp`286%xhm
z1T`glqv$@6wOGgjQ?^IGr4_Q*CxSjvKpZgY1h=I35FG-t?v8TueBA*aQ9yE<!6R)0
zl8iHnO)Cm#O3KO+ndq~!rIQXBOHE9oEvec{5>h04PRr=bkS={Wki~si4x46LD`~U|
zSRgaYao%+x{I%+(TSAXBj;7_Ji!bSnPzy&h;3P?dK$2Tt$YwN}Pm(nzCgLY~C4NtW
zn8+$%R!BoK$qf^M0vdkOn|9#fDV1CLp16wF-$FKoU^~lte3kC@?1yE8<jWzAnt&P&
z9+%)3bpwlMODD^5uYznTqwd*fc(EX(l?ln8WqQmDSyxGIPf_VXB4k}9J1o3y&RYSG
zR7b7psgBXMN=R(qXm6N*LskKGIaoB32|(RW$W{~ux^*Bc4(8I1>O4i`uG%~h(4ai?
zyn{`xOGU*-spL&o$QIlbR<Q8Rhma#E(aV%SvorxI;#CrI7ZB!~4}QB>b!=fAtAuQ5
zPf<w=%Z*0NTaeI90o>e?BNX&(RVZk@<cEm~2u<4T9u1IVCaG)5btWLm60KokHi5Wt
zA2ldsT@DpL7~y^bSvA=Abj}-)Ix(^K3pho7b$xT&R>?M;cCzP7$mTw5fXO=E?h&%A
zQfd>)BrYIi^Qy9>0qBb-w?z%MBs+F$Q4*?kbqMM7A-69FvUn`KsmrM<r_ridBw_3B
zSOss-4V1{K=SWm2@1BaB&ah*wkTn{BHu`W51(0I^k{2Wy$0;i_G23>EN>-G}(ZA6j
zZWT?8cc~-ibb+NS;-iTj+b-j>ByS&$Bb(7EEhrzO+oSiCjwo?6C*u%?Y?RX&KI$9B
zj#XgNRIu7=dNwwE*}L1UP^37b0j}a@M>G~8Vja;UC>+sZ93IhFGO9aym^}{F$|*7S
zY>ppio2G`J%Ppn4dfE{&mflB?V`H+($wXd|9*rc-v<^BVN+{kEKE=>{_T>CWMEBYw
aqI=<-C@(u-@jrPv8@4Ms-~W$q&i)(FczfOe

delta 674
zcmYjPPiqrF6la@8Wn%r)LP1e@71E}KB)dzK)Wu8N2p&X>NKp`Rl6lz--OR+@NmD7}
zrT#f6G|s6PZ+-yDr|{sR2SE@&fd>V@fN$4`4g>RhzxQW;@6Eh><Gi|mcyaV_{?TTP
z+~_!fZHY?pJGa)$e#NhNE-Mx@pVX?!4F+&`fY8J?cvoo$tA0>h1K;%;6u6-WN=OxM
z=)C~yb?`k8YTg<_fAqR>=62sul_UUGq&@n!G-J95EuJ9sxr}YjsaL58hEi?CI?^Gl
zHn)Uq8}M8gG9a+SCR{6xvpdd;-JJShe@(r$2f5%htBRNp6MPK&Z2U1-b_#!(FqUF}
zd?_D0EA2rXqcT~&YI|V%S}FrON)Ht!0j<BJy?64->{E~(V%<s&6ow!MefxvWKVzr_
zwR~NPiPryRv7*2T4N}IQfk-L@qaj2CBm;B@j5HB4zv0qsYS7cWNdD>#j0ng!hmKUD
zqe+&x3Q3zsm>CJ0>@2M-`+0FO4@p-Kt+VvfZTK|oI+&QNB%)_xMAV@-h#*1*9&jOO
zfV-*ste)+aD%U2HVrgrs<6m|WQXggTP%9o$giAWmq@4_<FkNP+Pc7K*PT5WuuGr(b
zl5G_p*sn9s?a|o<vJVKquwTwWh7Zrb&(2S?KgY*&H=PqSA8xp9E^l8Tm|m6sg!GMA
MYGq)2w4A^E8$(UrYybcN

diff --git a/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps b/tools/rna_tools/vienna_rna/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps
index 6f635052809fd49622468a37ec267bb4830da0ed..6896ab562d87593ae1afa0dd376ba647f22b858c 100644
GIT binary patch
delta 1433
zcmc&!%Wl&^6jhK=RTs4jBv=5_*;oPzV#h#Ix+{-vkjg_yAe9PDJrieO;&E-KX^A5L
z0>wYTCm`|(NQgauz(=r!JCitVsk?=dlZ@`;oO7@5%~$Vt`-6A0(+nKfeUJ*4OC3LC
zxmd$X!LgpC2=1ZPSqtb{Mc@bR!`JO4A3i$1{TzPkT*cE=M=9$=Cni5z!z~`baa_F6
z<>Sj&J~lS*c+WT26Qy&sD38l92Nzw(sjNF9k}+kt_sxayl#ZN9(fGDdZY<s?0E{tm
z=*J#Uk^qxm8A7eoV}4`y5?HH5B&K9lu=O&qG|X^@SAju^ILdpL#_-RNB5tw!7n||A
zF0!1(oTVIzmT}%}Ho;RiL?-)*5>PT0bIBE6LU4i6NC_g{V??bqGYE-I$hCuVW$FA(
z!|^s$5JYVGAY&-4lQ}PyNM-6l%&i@vFdU~Oc%jnayP?bkm3_CiUjXqRh51c?dJyF`
zoiM@})n&12>LOk7DHU~<9Rn(AJ48q|K(Z@TcCyuD)EH@wBwApcpO~gGx;kY_S>!Q&
zo7BmdMekhsbLs8m&4qrW@P?Apbd2`<Y#;l5>U=iX8DmFMucwpg^@NOi)Sd$qa!?o2
z@@XBAr!3ACEgdnnSACk6_rln%EV&0hNRWk08Nc-rbwS)jh^dN-pM(&Vv76k0_H2*d
z0o|+2nIsc2yH>hL;F+mM0_O#;(C)hKqnOWDwS2XFtuZR|<!9H&wtkP+2P0%+cOc@B
zW`DX(bAYZh`M&&Pp|D%H<!o*LpQrc-#M{$`Buu6msMG+R7L|LO{zA9Q&zF8(%zAp5
Out+!}=BBGpHk?0BUWvj0

delta 443
zcmY*V!A`<J6ioF%Tw^0w3CUb~;DEG^EJ(bl=n)9<=4ojcXk5BYyA_ZSf53yJSFe6S
zKf%Nw@K?NRi(o?Xl6{$Z^Y+dB(2v?{t!kfICNYfbkTc~;zs(eH;V$NAa|hOWR;@F;
zRd2#Jt;Xt}>XgE^Ow_F=D79B_4ZR!W%BTfmK*^+7DkVhgScY-MN1opcrH~_1>vt{#
zAr&msgzGs9E+3LDILIf{7wxm4EtCF1<znGT8DhbNWG(_3KzKe^a*3e~nGj0=2HcQM
zA!C(uU=bLmV<~w0eMt9`ivDoiu(Mk!RLJ~DWX{r+9%#=QN->EABJYW3w>-j)14IrJ
zoZt_fO*|h_Jiu(iX6wdY53UvSEjiyIGwuIJWQl?2yK9f!ce8+Re0P(?(T?dvFP4*P
jvA3Vak-itd3Mo4|)XD~;v7EwFB!2@o;$*X@drN)+Hv)}4

diff --git a/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta b/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta
index c25fd5b0f9..860121b1b3 100644
--- a/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta
+++ b/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta
@@ -1,3 +1,3 @@
->test_seq mfe: -13.6
-ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
-.(((((((((.......)))))))))........
+>test_seq mfe: 0
+>test_seq
+.........
diff --git a/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt
index f08c9e6e10..2dad8b4ee4 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnaaliduplex_result1.txt
@@ -1 +1 @@
-(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))).   1,73  :   1,73  (-40.30)
+.((.(((((...(((((((((((.(((((.(((((((&.)).)))))...))))))))))).))))).)))))))  37,73  :  37,73  (-36.65)
diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt
index a7024a007e..ee64b603a8 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result1.txt
@@ -1,2 +1,2 @@
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 +  -0.75)
diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt
index ab88d7b301..8c3eb618f8 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_result_MEA.txt
@@ -1,6 +1,6 @@
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-26.77]
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 +  -0.25 d=1.28}
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 +  -0.25 MEA=70.93}
- frequency of mfe structure in ensemble 0.773705; ensemble diversity 2.40  
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 +  -0.75)
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))}),. [-25.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. {-24.55 = -23.80 +  -0.75 d=3.22}
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. {-24.55 = -23.80 +  -0.75 MEA=68.37}
+ frequency of mfe structure in ensemble 0.58808; ensemble diversity 4.65  
diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt
index a7024a007e..ee64b603a8 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultfa.txt
@@ -1,2 +1,2 @@
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 +  -0.75)
diff --git a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt
index a7024a007e..ee64b603a8 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnaalifold_resultstk.txt
@@ -1,2 +1,2 @@
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-24.55 = -23.80 +  -0.75)
diff --git a/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt
index 396724bb31..1c43449c2a 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnacofold_result1.txt
@@ -1,3 +1,3 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-A
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
diff --git a/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt
index f03f5ffc4b..edb7e3cd82 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnaheat_result1.txt
@@ -1,102 +1,102 @@
 > comment 1
-0   0.0407267
-1   0.0435052
-2   0.0470227
-3   0.0505646
-4   0.0553391
-5   0.0603894
-6   0.0662047
-7   0.0718158
-8   0.0782007
-9   0.0863514
-10   0.0950516
-11   0.10505
-12   0.115613
-13   0.128245
-14   0.141712
-15   0.157281
-16   0.17497
-17   0.195056
-18   0.216799
-19   0.241743
-20   0.270432
-21   0.302132
-22   0.337644
-23   0.377263
-24   0.421546
-25   0.470799
-26   0.525589
-27   0.587016
-28   0.653829
-29   0.726606
-30   0.806458
-31   0.892656
-32   0.984857
-33   1.08272
-34   1.18601
-35   1.29332
-36   1.40305
-37   1.51467
-38   1.62618
-39   1.73524
-40   1.84032
-41   1.9407
-42   2.03385
-43   2.11859
-44   2.19443
-45   2.26182
-46   2.31999
-47   2.36969
-48   2.41182
-49   2.44826
-50   2.47967
-51   2.50769
-52   2.534
-53   2.55942
-54   2.5851
-55   2.61217
-56   2.64151
-57   2.67329
-58   2.70759
-59   2.74465
-60   2.78458
-61   2.8279
-62   2.8742
-63   2.92425
-64   2.97698
-65   3.03283
-66   3.09163
-67   3.15591
-68   3.23033
-69   3.3067
-70   3.38122
-71   3.45791
-72   3.54606
-73   3.63843
-74   3.73392
-75   3.83847
-76   3.94646
-77   4.05462
-78   4.16571
-79   4.28366
-80   4.39944
-81   4.50863
-82   4.61035
-83   4.70186
-84   4.78345
-85   4.85204
-86   4.90509
-87   4.9392
-88   4.95425
-89   4.95214
-90   4.93688
-91   4.91166
-92   4.87691
-93   4.8314
-94   4.78561
-95   4.75271
-96   4.71866
-97   4.66056
-98   4.57671
-99   4.48395
-100   4.39006
+0	0.0407267
+1	0.0435052
+2	0.0470227
+3	0.0505646
+4	0.0553391
+5	0.0603894
+6	0.0662047
+7	0.0718158
+8	0.0782007
+9	0.0863514
+10	0.0950516
+11	0.10505
+12	0.115613
+13	0.128245
+14	0.141712
+15	0.157281
+16	0.17497
+17	0.195056
+18	0.216799
+19	0.241743
+20	0.270432
+21	0.302132
+22	0.337644
+23	0.377263
+24	0.421546
+25	0.470799
+26	0.525589
+27	0.587016
+28	0.653829
+29	0.726606
+30	0.806458
+31	0.892656
+32	0.984857
+33	1.08272
+34	1.18601
+35	1.29332
+36	1.40305
+37	1.51467
+38	1.62618
+39	1.73524
+40	1.84032
+41	1.9407
+42	2.03385
+43	2.11859
+44	2.19443
+45	2.26182
+46	2.31999
+47	2.36969
+48	2.41182
+49	2.44826
+50	2.47967
+51	2.50769
+52	2.534
+53	2.55942
+54	2.5851
+55	2.61217
+56	2.64151
+57	2.67329
+58	2.70759
+59	2.74465
+60	2.78458
+61	2.8279
+62	2.8742
+63	2.92425
+64	2.97698
+65	3.03283
+66	3.09163
+67	3.15591
+68	3.23033
+69	3.3067
+70	3.38122
+71	3.45791
+72	3.54606
+73	3.63843
+74	3.73392
+75	3.83847
+76	3.94646
+77	4.05462
+78	4.16571
+79	4.28366
+80	4.39944
+81	4.50863
+82	4.61035
+83	4.70186
+84	4.78345
+85	4.85204
+86	4.90509
+87	4.9392
+88	4.95425
+89	4.95214
+90	4.93688
+91	4.91166
+92	4.87691
+93	4.8314
+94	4.78561
+95	4.75271
+96	4.71866
+97	4.66056
+98	4.57671
+99	4.48395
+100	4.39006
diff --git a/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt
index 650ed23cab..1b0a1a5f90 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnalalifold_result1.txt
@@ -1,4 +1,9 @@
-(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05)   17 -   73
-((((........)))). ( -5.10)   10 -   26
+.(((..((((....)))).))). ( -3.40)   51 -   73
+.((((..(((((.......)))))..)))). (-11.55)   42 -   72
+.((.(((((...(((((.......))))).))))))) (-13.35)   37 -   73
+.(.(((((.......))))).). ( -7.20)   24 -   46
+.((.(((((.......)))))..)). ( -7.90)   23 -   48
+.((.((((....)))).)). ( -4.70)   18 -   37
+.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05)   16 -   73
+.((((........)))). ( -5.30)    9 -   26
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
-
diff --git a/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt
index c94f1c34fb..b1ac8d3fda 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnalfold_result1.txt
@@ -1,28 +1,24 @@
 >Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
-.((((....)))).	( -0.10)	56
 .(((..((((....)))).))).	( -3.40)	51
-.(((((.......))))).	( -7.70)	48
 .((((..(((((.......)))))..)))).	(-10.30)	42
-.(((((...(((((.......))))).))))).	(-11.50)	40
 .((.(((((...(((((.......))))).)))))))	(-12.10)	37
-.(((((.......))))).	( -5.80)	26
+.(.(((((.......))))).).	( -6.00)	24
 .((.(((((.......)))))..)).	( -6.70)	23
-.((((....)))).	( -3.20)	21
 .((.((((....)))).)).	( -4.70)	18
-.((((........)))).	( -5.30)	9
+.((((.(((.(.((((....))))).))).)))).	(-10.50)	10
+.(((....((((........)))).(((((.......))))).....(((((.......)))))....))).	(-20.70)	2
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).	(-22.00)	1
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
  (-22.00)
 >Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 .(((..((((....)))).))).	( -3.40)	51
-.(((((.......))))).	( -9.20)	48
 .((((..(((((.......)))))..)))).	(-11.80)	42
-.(((((...(((((.......))))).))))).	(-13.30)	40
 .((.(((((...(((((.......))))).)))))))	(-13.60)	37
-.(((((.......))))).	( -7.70)	26
+.(.(((((.......))))).).	( -7.90)	24
 .((.(((((.......)))))..)).	( -8.60)	23
+.((.((((....)))).)).	( -4.70)	18
 .(((.(((((.(((((.......)))))..)).(((((.......)))))..))))))	(-20.00)	16
-.((((........)))).	( -5.30)	9
+.(((....((((........)))).(((((.......))))).....(((((.......)))))....))).	(-24.10)	2
 (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).	(-29.60)	1
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
  (-29.60)
diff --git a/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt
index 719c2cc6e7..0516f3d3d9 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnapkplex_result1.txt
@@ -1,6 +1,6 @@
 >Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
-.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90)
+.((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......))))))))))).. (-37.10)
 >Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
-(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
+(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-44.70)
diff --git a/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt b/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt
index da8d4bacc7..51bb70413a 100644
--- a/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt
+++ b/tools/rna_tools/vienna_rna/test-data/rnasubopt_result1.txt
@@ -1,7 +1,8 @@
->Anolis_caro_chrUn_GL343590.trna2-AlaAGC [0]
-UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00   0.00
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55 [100]
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00   1.00
 (((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). -21.90
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00
->Anolis_caro_chrUn_GL343207.trna3-AlaAGC [0]
-GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60   0.00
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15 [100]
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60   1.00
 (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
diff --git a/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular b/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular
index 70bae771af..e69de29bb2 100644
--- a/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular
+++ b/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular
@@ -1,10 +0,0 @@
-..(((....)))	-0.4	0.0550686	3.9	6.46108	12	
-.((((....))))	-3	0.0600001	5.96046e-09	6.46108	13
-(((((....)))))	-4.7	0.065	0	6.46108	14
-(((((....)))))..((((....))))	-5.3	0.135069	3.9	6.46108	28
-(((((....))))).(((((....)))))	-5.8	0.14	1.90735e-07	6.46108	29
-(((((....))))).......(((....)))...	-6.9	0.17246	6.7	7.46108	34
-(((((....)))))......((((....))))..	-7.8	0.17246	9.53674e-08	7.46108	34
-(((((....))))).....(((((....))))).	-10.7	0.17246	1.90735e-07	7.46108	34
-(((((....)))))....((((((....))))))	-13.1	0.17246	-1.90735e-07	7.46108	34
-.(((((((((.......)))))))))........	-13.6	123.457	12.5	13	34

From 347fc608aa36ca37031740db0fe7b8b5372c75e2 Mon Sep 17 00:00:00 2001
From: Bjoern Gruening <bjoern.gruening@gmail.com>
Date: Sun, 30 Aug 2026 15:39:14 +0200
Subject: [PATCH 2/4] kinwalker fixes

---
 tools/rna_tools/vienna_rna/kinwalker.xml      | 26 +++++++++++--------
 .../test-data/mfe_struct_result.fasta         |  6 ++---
 .../test-data/trajectory_result.tabular       | 10 +++++++
 3 files changed, 28 insertions(+), 14 deletions(-)

diff --git a/tools/rna_tools/vienna_rna/kinwalker.xml b/tools/rna_tools/vienna_rna/kinwalker.xml
index 069cb36e8a..72c3c70747 100644
--- a/tools/rna_tools/vienna_rna/kinwalker.xml
+++ b/tools/rna_tools/vienna_rna/kinwalker.xml
@@ -2,14 +2,18 @@
     <description>Simulate cotranscriptional folding of RNAs</description>
     <macros>
         <token name="@EXECUTABLE@">kinwalker</token>
+        <token name="@TOOL_VERSION@">2.6.4</token>
         <import>macros.xml</import>
     </macros>
     <expand macro="xrefs"/>
     <expand macro="creator"/>
     <expand macro="requirements"/>
+
     <command detect_errors="aggressive"><![CDATA[
     head -n 1 '$input_sequence' | head -c -1 -q  > seq.ident
     &&
+    sed '1d' '$input_sequence' > input.seq
+    &&
     kinwalker
         $init_structure
         $interrupt
@@ -25,7 +29,7 @@
         --transcribed $transcribed
         --transcription_rate $transcription_rate
         --windowsize $windowsize
-        < '$input_sequence'
+        < input.seq
         > blah
     &&
     sed -n '2s/[\.\(\)]\+\s\+\(.\+\)$/ mfe: \1/p' blah > energy
@@ -39,8 +43,8 @@
     </command>
     <inputs>
         <param name="input_sequence" format="fasta" type="data" label="Input sequence" help="A single sequence in FASTA format"/>
-        <param argument="--init_structure" type="boolean" truevalue="--init_structure" falsevalue="" checked="false" label="Start with a structure other than the open chain"/>
-        <param argument="--interrupt" type="boolean" truevalue="--interrupt" falsevalue="" checked="false" label="Allow interrupted folding trajectories when the barrier is exceeded"/>
+        <param argument="--init_structure" name="init_structure" type="boolean" truevalue="--init_structure" falsevalue="" checked="false" label="Start with a structure other than the open chain"/>
+        <param argument="--interrupt" name="interrupt" type="boolean" truevalue="--interrupt" falsevalue="" checked="false" label="Allow interrupted folding trajectories when the barrier is exceeded"/>
         <conditional name="barrier_heuristic">
             <param argument="--barrier_heuristic" name="used" type="select" label="Barrier Heuristic">
                 <option value="M" selected="true">Morgan-Higgs</option>
@@ -49,27 +53,27 @@
                 <option value="A">All</option>
             </param>
             <when value="M">
-                <param argument="--grouping" type="select" label="How to treat conflict groups">
+                <param argument="--grouping" name="grouping" type="select" label="How to treat conflict groups">
                     <option value="standard" selected="true">Standard</option>
                     <option value="regroup">Re-group</option>
                 </param>
-                <param argument="--lookahead" type="integer" value="1" label="Number of base pairs that MorganHiggs forms its subpaths from"/>
+                <param argument="--lookahead" name="lookahead" type="integer" value="1" label="Number of base pairs that MorganHiggs forms its subpaths from"/>
             </when>
             <when value="S"/>
             <when value="B">
-                <param argument="--maxkeep" type="integer" value="1" label="Breadth of breadth-first search"/>
+                <param argument="--maxkeep" name="maxkeep" type="integer" value="1" label="Breadth of breadth-first search"/>
             </when>
             <when value="A"/>
         </conditional>
-        <param argument="--dangle" type="select" label="Dangle value">
+        <param argument="--dangle" name="dangle" type="select" label="Dangle value">
             <option value="0" selected="true">0</option>
             <option value="1">1</option>
             <option value="2">2</option>
         </param>
-        <param argument="--noLonelyPairs" type="integer" value="2" label="Value of noLonelyPairs"/>
-        <param argument="--transcribed" type="integer" value="1" label="Number of bases initially transcribed" help="0 means all are transcribed"/>
-        <param argument="--transcription_rate" type="float" value="200" label="Number of bases transcribed per second"/>
-        <param argument="--windowsize" type="integer" value="0" label="Max size of substructures considered for folding events during transcription" help="0 = all are considered"/>
+        <param argument="--noLonelyPairs" name="noLonelyPairs" type="integer" value="2" label="Value of noLonelyPairs"/>
+        <param argument="--transcribed" name="transcribed" type="integer" value="1" label="Number of bases initially transcribed" help="0 means all are transcribed"/>
+        <param argument="--transcription_rate" name="transcription_rate" type="float" value="200" label="Number of bases transcribed per second"/>
+        <param argument="--windowsize" name="windowsize" type="integer" value="0" label="Max size of substructures considered for folding events during transcription" help="0 = all are considered"/>
     </inputs>
     <outputs>
         <data format="fasta" name="mfe_struct" label="MFE structure from ${tool.name} on ${on_string}"/>
diff --git a/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta b/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta
index 860121b1b3..c25fd5b0f9 100644
--- a/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta
+++ b/tools/rna_tools/vienna_rna/test-data/mfe_struct_result.fasta
@@ -1,3 +1,3 @@
->test_seq mfe: 0
->test_seq
-.........
+>test_seq mfe: -13.6
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
+.(((((((((.......)))))))))........
diff --git a/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular b/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular
index e69de29bb2..70bae771af 100644
--- a/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular
+++ b/tools/rna_tools/vienna_rna/test-data/trajectory_result.tabular
@@ -0,0 +1,10 @@
+..(((....)))	-0.4	0.0550686	3.9	6.46108	12	
+.((((....))))	-3	0.0600001	5.96046e-09	6.46108	13
+(((((....)))))	-4.7	0.065	0	6.46108	14
+(((((....)))))..((((....))))	-5.3	0.135069	3.9	6.46108	28
+(((((....))))).(((((....)))))	-5.8	0.14	1.90735e-07	6.46108	29
+(((((....))))).......(((....)))...	-6.9	0.17246	6.7	7.46108	34
+(((((....)))))......((((....))))..	-7.8	0.17246	9.53674e-08	7.46108	34
+(((((....))))).....(((((....))))).	-10.7	0.17246	1.90735e-07	7.46108	34
+(((((....)))))....((((((....))))))	-13.1	0.17246	-1.90735e-07	7.46108	34
+.(((((((((.......)))))))))........	-13.6	123.457	12.5	13	34

From c883eeb1e7dfd087426f94be8a00f82b8535f41c Mon Sep 17 00:00:00 2001
From: Bjoern Gruening <bjoern.gruening@gmail.com>
Date: Fri, 4 Sep 2026 17:08:15 +0200
Subject: [PATCH 3/4] fix linting

---
 tools/rna_tools/vienna_rna/kinfold.xml      | 26 ++++++++++-----------
 tools/rna_tools/vienna_rna/kinwalker.xml    | 20 ++++++++--------
 tools/rna_tools/vienna_rna/rna2dfold.xml    |  2 +-
 tools/rna_tools/vienna_rna/rnaaliduplex.xml |  2 +-
 tools/rna_tools/vienna_rna/rnacofold.xml    | 16 ++++++-------
 tools/rna_tools/vienna_rna/rnadistance.xml  |  4 ++--
 tools/rna_tools/vienna_rna/rnaeval.xml      |  6 ++---
 tools/rna_tools/vienna_rna/rnafold.xml      | 20 ++++++++--------
 tools/rna_tools/vienna_rna/rnalalifold.xml  |  6 ++---
 tools/rna_tools/vienna_rna/rnalfold.xml     |  2 +-
 tools/rna_tools/vienna_rna/rnapaln.xml      |  8 +++----
 tools/rna_tools/vienna_rna/rnapdist.xml     |  4 ++--
 tools/rna_tools/vienna_rna/rnapkplex.xml    |  4 ++--
 tools/rna_tools/vienna_rna/rnaplfold.xml    |  8 +++----
 tools/rna_tools/vienna_rna/rnaplot.xml      |  4 ++--
 tools/rna_tools/vienna_rna/rnasnoop.xml     |  2 +-
 tools/rna_tools/vienna_rna/rnasubopt.xml    | 10 ++++----
 tools/rna_tools/vienna_rna/rnaup.xml        |  8 +++----
 18 files changed, 76 insertions(+), 76 deletions(-)

diff --git a/tools/rna_tools/vienna_rna/kinfold.xml b/tools/rna_tools/vienna_rna/kinfold.xml
index 1371135a5d..31f47a7a4d 100644
--- a/tools/rna_tools/vienna_rna/kinfold.xml
+++ b/tools/rna_tools/vienna_rna/kinfold.xml
@@ -29,28 +29,28 @@
     </command>
     <inputs>
         <param format="txt" name="input" type="data" label="Input file"/>
-        <param argument="--Temp" name="Temp" type="float" value="37.0" label="Temperature [°C]"/>
-        <param argument="--dangle" name="dangle" type="select" label="How to treat dangling end energies">
+        <param argument="--Temp" type="float" value="37.0" label="Temperature [°C]"/>
+        <param argument="--dangle" type="select" label="How to treat dangling end energies">
             <option value="0">0: none</option>
             <option value="2" selected="true">2: double</option>
             <option value="1">1: normal</option>
         </param>
-        <param argument="--logML" name="logML" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Logarithmic energy functions for multi-loops"/>
+        <param argument="--logML" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Logarithmic energy functions for multi-loops"/>
         <section name="move_set_options" title="Move set options">
-            <param argument="--noShift" name="noShift" type="boolean" truevalue="" falsevalue="--noShift" checked="true" label="Turn on shift moves"/>
-            <param argument="--noLP" name="noLP" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow structures containing isolated base-pairs"/>
+            <param argument="--noShift" type="boolean" truevalue="" falsevalue="--noShift" checked="true" label="Turn on shift moves"/>
+            <param argument="--noLP" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow structures containing isolated base-pairs"/>
         </section>
         <section name="simulation_options" title="Simulation options">
-            <param argument="--num" name="num" type="integer" value="1" optional="true" label="Number of trajectories to compute"/>
-            <param argument="--time" name="time" type="float" value="500.0" optional="true" label="Set maximum length of folding trajectory" help="The default (500) is very short and meant for testing purposes only."/>
-            <param argument="--grow" name="grow" type="float" value="0" optional="true" label="Simulate folding during transcription" help="Chain growth event taking place every rate timesteps."/>
-            <param argument="--glen" name="glen" type="integer" value="15" optional="true" label="Initial chain length for transcription simulation"/>
-            <param argument="--fpt" name="fpt" type="boolean" truevalue="--fpt" falsevalue="" checked="true" label="Compute first passage time" help="Stop when a stop-structure is reached."/>
-            <param argument="--met" name="met" type="boolean" truevalue="--met" falsevalue="" checked="false" label="Use the Metropolis rule for rate between two neighboring conformations" help="Use k=min{1,exp(-dE/RT)}. By default Kinfold uses the symmetric Kawasaki rule k=exp(-dE/2RT)."/>
+            <param argument="--num" type="integer" value="1" optional="true" label="Number of trajectories to compute"/>
+            <param argument="--time" type="float" value="500.0" optional="true" label="Set maximum length of folding trajectory" help="The default (500) is very short and meant for testing purposes only."/>
+            <param argument="--grow" type="float" value="0" optional="true" label="Simulate folding during transcription" help="Chain growth event taking place every rate timesteps."/>
+            <param argument="--glen" type="integer" value="15" optional="true" label="Initial chain length for transcription simulation"/>
+            <param argument="--fpt" type="boolean" truevalue="--fpt" falsevalue="" checked="true" label="Compute first passage time" help="Stop when a stop-structure is reached."/>
+            <param argument="--met" type="boolean" truevalue="--met" falsevalue="" checked="false" label="Use the Metropolis rule for rate between two neighboring conformations" help="Use k=min{1,exp(-dE/RT)}. By default Kinfold uses the symmetric Kawasaki rule k=exp(-dE/2RT)."/>
         </section>
         <section name="output_options" title="Output Options">
-            <param argument="--lmin" name="lmin" type="boolean" truevalue="--lmin" falsevalue="" checked="false" label="Print only local minima encountered"/>
-            <param argument="--cut" name="cut" type="float" value="20.0" optional="true" label="Cutoff energy" help="Print only those parts of the trajectory that stay below this energy."/>
+            <param argument="--lmin" type="boolean" truevalue="--lmin" falsevalue="" checked="false" label="Print only local minima encountered"/>
+            <param argument="--cut" type="float" value="20.0" optional="true" label="Cutoff energy" help="Print only those parts of the trajectory that stay below this energy."/>
         </section>
     </inputs>
     <outputs>
diff --git a/tools/rna_tools/vienna_rna/kinwalker.xml b/tools/rna_tools/vienna_rna/kinwalker.xml
index 72c3c70747..fb08407a6e 100644
--- a/tools/rna_tools/vienna_rna/kinwalker.xml
+++ b/tools/rna_tools/vienna_rna/kinwalker.xml
@@ -43,8 +43,8 @@
     </command>
     <inputs>
         <param name="input_sequence" format="fasta" type="data" label="Input sequence" help="A single sequence in FASTA format"/>
-        <param argument="--init_structure" name="init_structure" type="boolean" truevalue="--init_structure" falsevalue="" checked="false" label="Start with a structure other than the open chain"/>
-        <param argument="--interrupt" name="interrupt" type="boolean" truevalue="--interrupt" falsevalue="" checked="false" label="Allow interrupted folding trajectories when the barrier is exceeded"/>
+        <param argument="--init_structure" type="boolean" truevalue="--init_structure" falsevalue="" checked="false" label="Start with a structure other than the open chain"/>
+        <param argument="--interrupt" type="boolean" truevalue="--interrupt" falsevalue="" checked="false" label="Allow interrupted folding trajectories when the barrier is exceeded"/>
         <conditional name="barrier_heuristic">
             <param argument="--barrier_heuristic" name="used" type="select" label="Barrier Heuristic">
                 <option value="M" selected="true">Morgan-Higgs</option>
@@ -53,27 +53,27 @@
                 <option value="A">All</option>
             </param>
             <when value="M">
-                <param argument="--grouping" name="grouping" type="select" label="How to treat conflict groups">
+                <param argument="--grouping" type="select" label="How to treat conflict groups">
                     <option value="standard" selected="true">Standard</option>
                     <option value="regroup">Re-group</option>
                 </param>
-                <param argument="--lookahead" name="lookahead" type="integer" value="1" label="Number of base pairs that MorganHiggs forms its subpaths from"/>
+                <param argument="--lookahead" type="integer" value="1" label="Number of base pairs that MorganHiggs forms its subpaths from"/>
             </when>
             <when value="S"/>
             <when value="B">
-                <param argument="--maxkeep" name="maxkeep" type="integer" value="1" label="Breadth of breadth-first search"/>
+                <param argument="--maxkeep" type="integer" value="1" label="Breadth of breadth-first search"/>
             </when>
             <when value="A"/>
         </conditional>
-        <param argument="--dangle" name="dangle" type="select" label="Dangle value">
+        <param argument="--dangle" type="select" label="Dangle value">
             <option value="0" selected="true">0</option>
             <option value="1">1</option>
             <option value="2">2</option>
         </param>
-        <param argument="--noLonelyPairs" name="noLonelyPairs" type="integer" value="2" label="Value of noLonelyPairs"/>
-        <param argument="--transcribed" name="transcribed" type="integer" value="1" label="Number of bases initially transcribed" help="0 means all are transcribed"/>
-        <param argument="--transcription_rate" name="transcription_rate" type="float" value="200" label="Number of bases transcribed per second"/>
-        <param argument="--windowsize" name="windowsize" type="integer" value="0" label="Max size of substructures considered for folding events during transcription" help="0 = all are considered"/>
+        <param argument="--noLonelyPairs" type="integer" value="2" label="Value of noLonelyPairs"/>
+        <param argument="--transcribed" type="integer" value="1" label="Number of bases initially transcribed" help="0 means all are transcribed"/>
+        <param argument="--transcription_rate" type="float" value="200" label="Number of bases transcribed per second"/>
+        <param argument="--windowsize" type="integer" value="0" label="Max size of substructures considered for folding events during transcription" help="0 = all are considered"/>
     </inputs>
     <outputs>
         <data format="fasta" name="mfe_struct" label="MFE structure from ${tool.name} on ${on_string}"/>
diff --git a/tools/rna_tools/vienna_rna/rna2dfold.xml b/tools/rna_tools/vienna_rna/rna2dfold.xml
index 9ed8932145..79d31c2207 100644
--- a/tools/rna_tools/vienna_rna/rna2dfold.xml
+++ b/tools/rna_tools/vienna_rna/rna2dfold.xml
@@ -38,7 +38,7 @@
             <option value="2" selected="true">Unpaired bases participate in all dangling ends (2)</option>
             <option value="0">Ignore dangling ends (0)</option>
         </param>
-        <param argument="--noBT" name="noBT" type="boolean" checked="true" truevalue="" falsevalue="--noBT" label="Backtrack structures (don't calculate energy contributions only)"/>
+        <param argument="--noBT" type="boolean" checked="true" truevalue="" falsevalue="--noBT" label="Backtrack structures (don't calculate energy contributions only)"/>
         <conditional name="pfselect">
             <param name="pf" type="select" label="Calculate partition function" help="--partfunc">
                 <option value="no">no</option>
diff --git a/tools/rna_tools/vienna_rna/rnaaliduplex.xml b/tools/rna_tools/vienna_rna/rnaaliduplex.xml
index 480b6335f5..04cdb9990e 100644
--- a/tools/rna_tools/vienna_rna/rnaaliduplex.xml
+++ b/tools/rna_tools/vienna_rna/rnaaliduplex.xml
@@ -39,7 +39,7 @@
             <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
             <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
             <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
-            <param argument="--nsp" name="nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs."/>
+            <param argument="--nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs."/>
         </section>
     </inputs>
     <outputs>
diff --git a/tools/rna_tools/vienna_rna/rnacofold.xml b/tools/rna_tools/vienna_rna/rnacofold.xml
index c74fb400b0..0d8e3b8427 100644
--- a/tools/rna_tools/vienna_rna/rnacofold.xml
+++ b/tools/rna_tools/vienna_rna/rnacofold.xml
@@ -60,16 +60,16 @@
 ]]>
     </command>
     <inputs>
-        <param argument="--input" format="fasta" name="input" type="data" label="FASTA file"/>
+        <param argument="--input" format="fasta" type="data" label="FASTA file"/>
         <section name="general_options" title="General Options">
-            <param argument="--noPS" name="noPS" type="boolean" truevalue="" falsevalue="--noPS" checked="true" label="Produce postscript output"/>
+            <param argument="--noPS" type="boolean" truevalue="" falsevalue="--noPS" checked="true" label="Produce postscript output"/>
             <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)" help="Avoids confusion with DNA sequences"/>
         </section>
         <section name="IDs" title="Naming Conventions">
-            <param argument="--auto-id" name="auto_id" type="boolean" truevalue="--auto-id" falsevalue="" checked="false" label="Automatically generate an ID for each sequence." help="If active, RNAcofold ignores any IDs retrieved from the input and automatically generates an ID for each sequence."/>
-            <param argument="--id-prefix" name="id_prefix" type="text" value="alignment" label="Prefix for automatically generated IDs (as used in output file names)"/>
-            <param argument="--id-digits" name="id_digits" type="integer" value="4" min="1" max="18" label="Number of digits in automatically generated sequence IDs"/>
-            <param argument="--id-start" name="id_start" type="integer" value="1" min="0" label="First number in automatically generated sequence IDs"/>
+            <param argument="--auto-id" type="boolean" truevalue="--auto-id" falsevalue="" checked="false" label="Automatically generate an ID for each sequence." help="If active, RNAcofold ignores any IDs retrieved from the input and automatically generates an ID for each sequence."/>
+            <param argument="--id-prefix" type="text" value="alignment" label="Prefix for automatically generated IDs (as used in output file names)"/>
+            <param argument="--id-digits" type="integer" value="4" min="1" max="18" label="Number of digits in automatically generated sequence IDs"/>
+            <param argument="--id-start" type="integer" value="1" min="0" label="First number in automatically generated sequence IDs"/>
         </section>
         <section name="model_options" title="Model Options" expanded="true">
             <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/>
@@ -83,8 +83,8 @@
             <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
             <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
             <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
-            <param argument="--nsp" name="nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs, e.g. GA."/>
-            <param argument="--betaScale" name="betaScale" type="float" value="1.0" label="Scaling of Boltzmann factors"/>
+            <param argument="--nsp" type="text" value="" label="Allow non-standard pairs in addition to AU, GC, and GU pairs." help="Comma-separated list of additionally allowed pairs, e.g. GA."/>
+            <param argument="--betaScale" type="float" value="1.0" label="Scaling of Boltzmann factors"/>
         </section>
         <section name="constraints" title="Structure constraints">
             <conditional name="constraintLocation">
diff --git a/tools/rna_tools/vienna_rna/rnadistance.xml b/tools/rna_tools/vienna_rna/rnadistance.xml
index beefba47a8..d93f180033 100644
--- a/tools/rna_tools/vienna_rna/rnadistance.xml
+++ b/tools/rna_tools/vienna_rna/rnadistance.xml
@@ -21,7 +21,7 @@
     </command>
     <inputs>
         <param name="input" type="data" format="txt" label="Structures file (sequence + dot-bracket notation)"/>
-        <param argument="--distance" name="distance" type="select" multiple="true" label="Representation to calculate the distance">
+        <param argument="--distance" type="select" multiple="true" label="Representation to calculate the distance">
             <option value="f" selected="true">full/tree</option>
             <option value="F">full/string</option>
             <option value="h">hit/tree</option>
@@ -32,7 +32,7 @@
             <option value="C">coarse/string</option>
             <validator type="no_options" message="Please select at least one type."/>
         </param>
-        <param argument="--compare" name="compare" type="select" label="Comparison option">
+        <param argument="--compare" type="select" label="Comparison option">
             <option value="p" selected="true">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
             <option value="m">m: matrix (each with each, output in matrix form)</option>
             <option value="f">f: first (1st with 2nd, 1st with 3rd, ...)</option>
diff --git a/tools/rna_tools/vienna_rna/rnaeval.xml b/tools/rna_tools/vienna_rna/rnaeval.xml
index f373492ac3..44da10cc06 100644
--- a/tools/rna_tools/vienna_rna/rnaeval.xml
+++ b/tools/rna_tools/vienna_rna/rnaeval.xml
@@ -62,9 +62,9 @@
                 <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param argument="--verbose" name="verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Print out energy of each loop in the structure"/>
-                <param argument="--gquad" name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="G-quadruplex formation prediction"/>
-                <param argument="--circ" name="circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA"/>
+                <param argument="--verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Print out energy of each loop in the structure"/>
+                <param argument="--gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="G-quadruplex formation prediction"/>
+                <param argument="--circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA"/>
                 <param argument="--logML" name="logml" type="boolean" truevalue="--logML" falsevalue="" checked="false" label="Logarithmic energy functions for multi-loops"/>
                 <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
                 <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
diff --git a/tools/rna_tools/vienna_rna/rnafold.xml b/tools/rna_tools/vienna_rna/rnafold.xml
index 1e9915923b..bd73e7d784 100644
--- a/tools/rna_tools/vienna_rna/rnafold.xml
+++ b/tools/rna_tools/vienna_rna/rnafold.xml
@@ -139,7 +139,7 @@
             <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type">
+        <param type="select" label="Layout algorithm" argument="--layout_type">
             <option value="1" selected="true">Default: Naview layout</option>
             <option value="0">Simple radial layout</option>
         </param>
@@ -156,12 +156,12 @@
             <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)" help="Avoids confusion with DNA sequences (--noconv)"/>
             <param name="gquad" type="boolean" truevalue="--gquad" falsevalue="" checked="false" label="Take G Quadruplex formation into account" argument="-g"/>
             <param name="circular" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Model as circular RNA structure" argument="--circ"/>
-            <param name="bppmThreshold" type="float" value="1e-5" label="Threshold for base pair probabilities" help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." argument="--bppmThreshold"/>
-            <param name="nsp" type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs." help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." argument="--nsp"/>
-            <param name="betaScale" type="float" value="1.0" label="Scaling of Boltzman factors" help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." argument="--betaScale"/>
+            <param type="float" value="1e-5" label="Threshold for base pair probabilities" help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." argument="--bppmThreshold"/>
+            <param type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs." help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA  will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." argument="--nsp"/>
+            <param type="float" value="1.0" label="Scaling of Boltzman factors" help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." argument="--betaScale"/>
         </section>
         <section name="constraints" title="Structure constraints">
-            <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
+            <param type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
             <conditional name="constraintLocation">
                 <param name="constraintSelector" type="select" label="Constraints">
                     <!-- <option value="fromInput">The constraints are included in the input file</option> -->
@@ -174,7 +174,7 @@
                 <when value="inFile"/>
                 <when value="fromFile">
                     <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/>
-                    <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" label="Use constraints for all alignment records" help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them." argument="--batch"/>
+                    <param type="boolean" checked="false" truevalue="--batch" falsevalue="" label="Use constraints for all alignment records" help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them." argument="--batch"/>
                     <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint"/>
                     <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint"/>
                 </when>
@@ -238,10 +238,10 @@
             </param>
         </section>
         <section name="IDs" title="Naming Conventions">
-            <param name="auto_id" type="boolean" truevalue="--auto-id" falsevalue="" checked="false" label="Automatically generate an ID for each alignment." help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence." argument="--auto-id"/>
-            <param name="id_prefix" type="text" value="sequence" label="Prefix for automatically generated IDs (as used in output file names)" help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence." argument="--id-prefix"/>
-            <param name="id_digits" type="integer" value="4" min="1" max="18" label="The number of digits of the counter in automatically generated sequence IDs" help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." argument="--id-digits"/>
-            <param name="id_start" type="integer" value="1" min="0" label="First number in automatically generated sequence IDs" help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.." argument="--id-start"/>
+            <param type="boolean" truevalue="--auto-id" falsevalue="" checked="false" label="Automatically generate an ID for each alignment." help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence." argument="--auto-id"/>
+            <param type="text" value="sequence" label="Prefix for automatically generated IDs (as used in output file names)" help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence." argument="--id-prefix"/>
+            <param type="integer" value="4" min="1" max="18" label="The number of digits of the counter in automatically generated sequence IDs" help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." argument="--id-digits"/>
+            <param type="integer" value="1" min="0" label="First number in automatically generated sequence IDs" help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.." argument="--id-start"/>
         </section>
     </inputs>
     <outputs>
diff --git a/tools/rna_tools/vienna_rna/rnalalifold.xml b/tools/rna_tools/vienna_rna/rnalalifold.xml
index 187ed0d678..7d33d2c70b 100644
--- a/tools/rna_tools/vienna_rna/rnalalifold.xml
+++ b/tools/rna_tools/vienna_rna/rnalalifold.xml
@@ -34,7 +34,7 @@
             <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param argument="--mis" name="mis" type="boolean" checked="false" truevalue="--mis" falsevalue="" label="Most Informative Sequence output"/>
+        <param argument="--mis" type="boolean" checked="false" truevalue="--mis" falsevalue="" label="Most Informative Sequence output"/>
         <conditional name="advancedOptions">
             <param name="advancedSelector" type="select" label="Advanced options">
                 <option value="basic">Basic options</option>
@@ -45,8 +45,8 @@
                 <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
                 <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
                 <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
-                <param argument="--cfactor" name="cfactor" type="float" value="1.0" label="Weight of the covariance term"/>
-                <param argument="--nfactor" name="nfactor" type="float" value="1.0" label="Penalty for non-compatible sequences in the covariance term"/>
+                <param argument="--cfactor" type="float" value="1.0" label="Weight of the covariance term"/>
+                <param argument="--nfactor" type="float" value="1.0" label="Penalty for non-compatible sequences in the covariance term"/>
                 <param argument="--ribosum_scoring" name="ribosum" type="boolean" truevalue="--ribosum_scoring" falsevalue="" checked="false" label="Use ribosum scoring matrix"/>
             </when>
             <when value="basic"/>
diff --git a/tools/rna_tools/vienna_rna/rnalfold.xml b/tools/rna_tools/vienna_rna/rnalfold.xml
index 555e783043..f63bfc32fc 100644
--- a/tools/rna_tools/vienna_rna/rnalfold.xml
+++ b/tools/rna_tools/vienna_rna/rnalfold.xml
@@ -51,7 +51,7 @@
                 <param argument="--noTetra" name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc."/>
                 <param argument="--noconv" name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -&gt; U)"/>
                 <param name="activateZscore" type="boolean" checked="false" truevalue="true" falsevalue="" label="Activate Z-score computation" help="--zscore"/>
-                <param argument="--zscore" name="zscore" type="float" value="-2" optional="true" label="Z-score threshold"/>
+                <param argument="--zscore" type="float" value="-2" optional="true" label="Z-score threshold"/>
             </when>
             <when value="basic"/>
         </conditional>
diff --git a/tools/rna_tools/vienna_rna/rnapaln.xml b/tools/rna_tools/vienna_rna/rnapaln.xml
index bdff959feb..5035aff931 100644
--- a/tools/rna_tools/vienna_rna/rnapaln.xml
+++ b/tools/rna_tools/vienna_rna/rnapaln.xml
@@ -45,10 +45,10 @@
             <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option>
         </param>
         <param argument="-B" name="backtrack" type="boolean" checked="true" truevalue="-B" falsevalue="" label="Print an alignment"/>
-        <param argument="--gapo" name="gapo" type="float" value="1.5" label="Gap open penalty"/>
-        <param argument="--gape" name="gape" type="float" value="0.67" label="Gap extension penalty"/>
-        <param argument="--seqw" name="seqw" type="float" value="0.5" label="Weight of sequence compared to structure"/>
-        <param argument="--endgaps" name="endgaps" type="boolean" checked="false" truevalue="--endgaps" falsevalue="" label="Allow free end-gaps"/>
+        <param argument="--gapo" type="float" value="1.5" label="Gap open penalty"/>
+        <param argument="--gape" type="float" value="0.67" label="Gap extension penalty"/>
+        <param argument="--seqw" type="float" value="0.5" label="Weight of sequence compared to structure"/>
+        <param argument="--endgaps" type="boolean" checked="false" truevalue="--endgaps" falsevalue="" label="Allow free end-gaps"/>
         <conditional name="advancedOptions">
             <param name="advancedSelector" type="select" label="Advanced options">
                 <option value="basic">Basic options</option>
diff --git a/tools/rna_tools/vienna_rna/rnapdist.xml b/tools/rna_tools/vienna_rna/rnapdist.xml
index d40daabcd4..db2c0ebe48 100644
--- a/tools/rna_tools/vienna_rna/rnapdist.xml
+++ b/tools/rna_tools/vienna_rna/rnapdist.xml
@@ -34,13 +34,13 @@
             <option value="2" selected="true">2: unpaired bases participate in all dangling ends</option>
             <option value="3">3: allow coaxial stacking</option>
         </param>
-        <param argument="--compare" name="compare" type="select" label="Comparison Option">
+        <param argument="--compare" type="select" label="Comparison Option">
             <option value="p" selected="true">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
             <option value="m">m: matrix (each with each, output in matrix form)</option>
             <option value="f">f: first (1st with 2nd, 1st with 3rd, ...)</option>
             <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option>
         </param>
-        <param argument="--backtrack" name="backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment"/>
+        <param argument="--backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment"/>
         <conditional name="advancedOptions">
             <param name="advancedSelector" type="select" label="Advanced options">
                 <option value="basic">Basic options</option>
diff --git a/tools/rna_tools/vienna_rna/rnapkplex.xml b/tools/rna_tools/vienna_rna/rnapkplex.xml
index c17fc84849..969c9d727c 100644
--- a/tools/rna_tools/vienna_rna/rnapkplex.xml
+++ b/tools/rna_tools/vienna_rna/rnapkplex.xml
@@ -35,8 +35,8 @@
             </param>
             <when value="advanced">
                 <param argument="--subopts" name="suboptimal" type="float" value="0.0" label="Print suboptimal pseudoknots"/>
-                <param argument="--verbose" name="verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Verbose mode, more output"/>
-                <param argument="--cutoff" name="cutoff" type="float" value="0.01" label="Cutoff probability for base pairs in the dot plot"/>
+                <param argument="--verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" label="Verbose mode, more output"/>
+                <param argument="--cutoff" type="float" value="0.01" label="Cutoff probability for base pairs in the dot plot"/>
                 <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
                 <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
                 <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
diff --git a/tools/rna_tools/vienna_rna/rnaplfold.xml b/tools/rna_tools/vienna_rna/rnaplfold.xml
index de01d09471..46aa333549 100644
--- a/tools/rna_tools/vienna_rna/rnaplfold.xml
+++ b/tools/rna_tools/vienna_rna/rnaplfold.xml
@@ -42,9 +42,9 @@
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
-        <param argument="--winsize" name="winsize" type="integer" value="70" label="Average pairing probabilities over this window size"/>
-        <param argument="--span" name="span" type="integer" value="70" label="Maximum separation between base pairs"/>
-        <param argument="--cutoff" name="cutoff" type="float" value="0.01" label="Cutoff probability for report on base pairing"/>
+        <param argument="--winsize" type="integer" value="70" label="Average pairing probabilities over this window size"/>
+        <param argument="--span" type="integer" value="70" label="Maximum separation between base pairs"/>
+        <param argument="--cutoff" type="float" value="0.01" label="Cutoff probability for report on base pairing"/>
         <param argument="--print_onthefly" name="onthefly" type="boolean" truevalue="--print_onthefly" falsevalue="" checked="false" label="Print simplified base pair probabilities (_basepairs output)"/>
         <param argument="--opening_energies" name="openingenergies" type="boolean" truevalue="--opening_energies" falsevalue="" checked="false" label="Output in logarithm of the probabilities (_openen output)"/>
         <conditional name="unpairedOption">
@@ -53,7 +53,7 @@
                 <option value="yes">Yes</option>
             </param>
             <when value="yes">
-                <param argument="--ulength" name="ulength" type="integer" value="31" label="Maximal length of unpaired region"/>
+                <param argument="--ulength" type="integer" value="31" label="Maximal length of unpaired region"/>
             </when>
             <when value="no"/>
         </conditional>
diff --git a/tools/rna_tools/vienna_rna/rnaplot.xml b/tools/rna_tools/vienna_rna/rnaplot.xml
index 03348f579a..c0afc75982 100644
--- a/tools/rna_tools/vienna_rna/rnaplot.xml
+++ b/tools/rna_tools/vienna_rna/rnaplot.xml
@@ -43,8 +43,8 @@
                 <option value="xrna">XRNA Save File (.ss)</option>
             </param>
             <when value="eps">
-                <param argument="--pre" name="pre" type="text" value="" optional="true" label="Add annotation macros to PostScript file"/>
-                <param argument="--post" name="post" type="text" value="" optional="true" label="Add annotations to PostScript file"/>
+                <param argument="--pre" type="text" value="" optional="true" label="Add annotation macros to PostScript file"/>
+                <param argument="--post" type="text" value="" optional="true" label="Add annotations to PostScript file"/>
             </when>
             <when value="gml"/>
             <when value="svg"/>
diff --git a/tools/rna_tools/vienna_rna/rnasnoop.xml b/tools/rna_tools/vienna_rna/rnasnoop.xml
index eca6bfa430..bfb586d5cf 100644
--- a/tools/rna_tools/vienna_rna/rnasnoop.xml
+++ b/tools/rna_tools/vienna_rna/rnasnoop.xml
@@ -57,7 +57,7 @@
             </when>
         </conditional>
         <param argument="--alignmentLength" name="length" type="integer" min="0" value="25" label="Maximal alignment length"/>
-        <param argument="--constraint" name="constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Calculate the stem structure subject to constraints"/>
+        <param argument="--constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Calculate the stem structure subject to constraints"/>
         <param argument="--energy-threshold" name="energyThreshold" type="float" value="-1.0" label="Maximal energy difference between the mfe and the desired suboptimal structure"/>
         <conditional name="advancedOptions">
             <param name="advancedSelector" type="select" label="Advanced options">
diff --git a/tools/rna_tools/vienna_rna/rnasubopt.xml b/tools/rna_tools/vienna_rna/rnasubopt.xml
index 079ecabc7c..89d74d81a8 100644
--- a/tools/rna_tools/vienna_rna/rnasubopt.xml
+++ b/tools/rna_tools/vienna_rna/rnasubopt.xml
@@ -78,9 +78,9 @@
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
-        <param argument="--sorted" name="sorted" type="boolean" truevalue="--sorted" falsevalue="" checked="false" label="Sort the secondary structures by energy"/>
-        <param argument="--dos" name="dos" type="boolean" truevalue="--dos" falsevalue="" checked="false" label="Calculate the density of states instead of the structure"/>
-        <param argument="--zuker" name="zuker" type="boolean" truevalue="--zuker" falsevalue="" checked="false" label="Calculate the Zuker suboptimals instead of the structures within a range"/>
+        <param argument="--sorted" type="boolean" truevalue="--sorted" falsevalue="" checked="false" label="Sort the secondary structures by energy"/>
+        <param argument="--dos" type="boolean" truevalue="--dos" falsevalue="" checked="false" label="Calculate the density of states instead of the structure"/>
+        <param argument="--zuker" type="boolean" truevalue="--zuker" falsevalue="" checked="false" label="Calculate the Zuker suboptimals instead of the structures within a range"/>
         <conditional name="methodOption">
             <param name="methodSelector" type="select" label="Select algorithm">
                 <option value="range" selected="true">Energy range</option>
@@ -109,7 +109,7 @@
                 <option value="advanced">Advanced options</option>
             </param>
             <when value="advanced">
-                <param argument="--circ" name="circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA structure"/>
+                <param argument="--circ" type="boolean" truevalue="--circ" falsevalue="" checked="false" label="Assume circular RNA structure"/>
                 <param argument="--noLP" name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs"/>
                 <param argument="--noGU" name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing"/>
                 <param argument="--noClosingGU" name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends"/>
@@ -120,7 +120,7 @@
             <when value="basic"/>
         </conditional>
         <section name="constraints" title="Structure constraints">
-            <param argument="--maxBPspan" name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span"/>
+            <param argument="--maxBPspan" type="integer" value="-1" label="Set the maximum base pair span"/>
             <conditional name="constraintLocation">
                 <param name="constraintSelector" type="select" label="Constraints">
                     <option value="fromFile">The constraints are in a separate file</option>
diff --git a/tools/rna_tools/vienna_rna/rnaup.xml b/tools/rna_tools/vienna_rna/rnaup.xml
index 36ae9e9af9..a2f643e8aa 100644
--- a/tools/rna_tools/vienna_rna/rnaup.xml
+++ b/tools/rna_tools/vienna_rna/rnaup.xml
@@ -41,9 +41,9 @@
             <option value="1">unpaired bases participate in one dangling end only (1)</option>
             <option value="3">allow coaxial stacking (3)</option>
         </param>
-        <param argument="--constraint" name="constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Constraints for the secondary structure"/>
-        <param argument="--ulength" name="ulength" type="integer" min="0" value="4" label="Length of the unstructured region"/>
-        <param argument="--contributions" name="contributions" type="select" multiple="true" label="Contributions to the probability of being unpaired">
+        <param argument="--constraint" type="boolean" truevalue="--constraint" falsevalue="" checked="false" label="Constraints for the secondary structure"/>
+        <param argument="--ulength" type="integer" min="0" value="4" label="Length of the unstructured region"/>
+        <param argument="--contributions" type="select" multiple="true" label="Contributions to the probability of being unpaired">
             <option value="S" selected="true">S: sum of all</option>
             <option value="H">H: unpaired within hairpin loop</option>
             <option value="I">I: unpaired within interior loop</option>
@@ -51,7 +51,7 @@
             <option value="E">E: unpaired within exterior loop</option>
             <validator type="no_options" message="Please select at least one contribution."/>
         </param>
-        <param argument="--window" name="window" type="integer" min="0" value="25" label="Maximal length of the region of interaction"/>
+        <param argument="--window" type="integer" min="0" value="25" label="Maximal length of the region of interaction"/>
         <param argument="--include_both" name="includeboth" type="boolean" truevalue="--include_both" falsevalue="" checked="false" label="Include the probability of unpaired regions in both RNAs"/>
         <param argument="--interaction_pairwise" name="interactionpairwise" type="boolean" truevalue="--interaction_pairwise" falsevalue="" checked="false" label="Activate pairwise interaction mode"/>
         <param argument="--interaction_first" name="interactionfirst" type="boolean" truevalue="--interaction_first" falsevalue="" checked="false" label="Activate pairwise interaction mode, compare always with the first sequence"/>

From 0e36b4c4112218de6a4ba9194279211602a37a67 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Bj=C3=B6rn=20Gr=C3=BCning?= <bjoern@gruenings.eu>
Date: Fri, 4 Sep 2026 17:40:00 +0200
Subject: [PATCH 4/4] Apply suggestion from @bgruening

---
 tools/rna_tools/vienna_rna/kinfold.xml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/tools/rna_tools/vienna_rna/kinfold.xml b/tools/rna_tools/vienna_rna/kinfold.xml
index 31f47a7a4d..2ed56875df 100644
--- a/tools/rna_tools/vienna_rna/kinfold.xml
+++ b/tools/rna_tools/vienna_rna/kinfold.xml
@@ -1,4 +1,4 @@
-<tool id="viennarna_kinfold" name="Kinfold" version="1.3.0.0" profile="@PROFILE@">
+<tool id="viennarna_kinfold" name="Kinfold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Simulate stochastic folding kinetics of RNA sequences</description>
     <macros>
         <token name="@EXECUTABLE@">Kinfold</token>