diff --git a/tools/rna_tools/srnatoolbox/.shed.yml b/tools/rna_tools/srnatoolbox/.shed.yml
new file mode 100644
index 0000000000..e69de29bb2
diff --git a/tools/rna_tools/srnatoolbox/macros.xml b/tools/rna_tools/srnatoolbox/macros.xml
new file mode 100644
index 0000000000..dd500b0432
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/macros.xml
@@ -0,0 +1,16 @@
+<macros>
+    
+    <token name="@TOOL_VERSION@">0.0.6</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <token name="@PROFILE@">25.0</token>
+    <xml name="requirements">
+        <requirements>
+            <container type="docker">ugrbioinfo/srnatoolbox</container>
+        </requirements>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/nar/gkz415</citation>
+        </citations>
+    </xml>
+</macros>
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/srna_mirnaconstargets_animal.xml b/tools/rna_tools/srnatoolbox/srna_mirnaconstargets_animal.xml
new file mode 100644
index 0000000000..bd1ac0216a
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/srna_mirnaconstargets_animal.xml
@@ -0,0 +1,91 @@
+<tool id="srna_mirnaconstargets_animal" name="sRNAtoolbox: miRNAconsTargets Animal" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>miRNA target prediction (animal)</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command><![CDATA[
+        #import re
+
+        mkdir output &&
+
+        #set $file = re.sub('[^\w\-_\.]', '_', $input_file.element_identifier)
+        ls -s '$input_file' '$file' &&
+
+        
+        #set $utr = re.sub('[^\w\-_\.]', '_', $utr_file.element_identifier)
+        ls -s '$utr_file' '$utr' &&
+
+        /srv/bin/miRNAconsTargets
+        '$input'
+        '$utr'
+        'output'
+        "\${GALAXY_SLOTS:-4}"
+        ${str($programs).replace(",",":")}
+
+        && 
+        #if 'SEED' in $programs:
+            mv 'output/seed*' '$seed_output'
+        #end if
+
+            
+    ]]></command>
+    <inputs>
+        <param name="input_file" type="data" format="fasta" label="Input miRNA file"/>
+        <param name="utr_file" type="data" format="fasta" label="Input UTR file"/>
+        <param name="programs" type="select" multiple="true" optional="false" label="Select at least one prediction program">
+            <option value="TS" selected="true">targetSpy</option>
+            <option value="PITA">pita</option>
+            <option value="MIRANDA">miranda</option>
+            <option value="SEED">Seed method</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data name="consensus" format="txt" from_work_dir="output/consensus.txt" label="${tool.name} on ${on_string}: consensus file"/>
+        <data name="seed_output" format="txt" label="${tool.name} on ${on_string}: seed algorithm file">
+            <filter>programs and "SEED" in programs</filter>
+        </data>
+        <data name="pita_origin" format="txt" from_work_dir="outputs/pita_orig.txt" label="${tool.name} on ${on_string}: pita origin file">
+            <filter>programs and "TS" in programs</filter>
+        </data>
+        <data name="pita" format="txt" from_work_dir="outputs/pita.txt" label="${tool.name} on ${on_string}: pita output file">
+            <filter>programs and "TS" in programs</filter>
+        </data>
+        <data name="miranda_origin" format="txt" from_work_dir="outputs/miranda_orig.txt" label="${tool.name} on ${on_string}: miranda origin file">
+            <filter>programs and "TS" in programs</filter>
+        </data>
+        <data name="miranda" format="txt" from_work_dir="outputs/miranda.txt" label="${tool.name} on ${on_string}: miranda output file">
+            <filter>programs and "TS" in programs</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test expect_num_outputs="2">
+            <param name="input_file" value="mirnas_test.fa" ftype="fasta"/>
+            <param name="utr_file" value="utr_test.fa" ftype="fasta"/>
+            <param name="programs" value="SEED"/>
+        </test>
+        <test expect_num_outputs="8">
+            <param name="input_file" value="mirnas_test.fa" ftype="fasta"/>
+            <param name="utr_file" value="utr_test.fa" ftype="fasta"/>
+            <param name="programs" value="SEED,TS,MIRANDA,PITA"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+        **What does this tool**
+
+        This tool runs multiple animal miRNA target-prediction methods and produce a consensus prediction then.
+
+        **Input**
+
+        - miRNA file (fasta format)
+        - UTR/target file (fasta format)
+
+        **Outputs**
+
+        - Consensus file
+        - for each method the origin file and the prediction (seed method does not have an origin file)
+        
+    ]]></help>
+    <expand macro="citations"/>
+</tool>
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/srna_mirnaconstargets_plant.xml b/tools/rna_tools/srnatoolbox/srna_mirnaconstargets_plant.xml
new file mode 100644
index 0000000000..b29e852c92
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/srna_mirnaconstargets_plant.xml
@@ -0,0 +1,86 @@
+<tool id="srna_mirnaconstargets_plant" name="sRNAtoolbox: miRNAconsTargets Plant" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>miRNA target prediction (plants)</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command><![CDATA[
+        #import re
+
+        mkdir output &&
+
+        #set $file = re.sub('[^\w\-_\.]', '_', $input_file.element_identifier)
+        ls -s '$input_file' '$file' &&
+
+        
+        #set $utr = re.sub('[^\w\-_\.]', '_', $utr_file.element_identifier)
+        ls -s '$utr_file' '$utr' &&
+
+        /srv/bin/miRNAconsTargets_plants
+        '$input'
+        '$utr'
+        'output'
+        "\${GALAXY_SLOTS:-4}"
+        ${str($programs).replace(",",":")}
+
+        &&
+
+        mv 'output/multipleTarget*' '$consensus_multi' &&
+        mv 'output/perTranscript*' '$consensus_transcript' &&   
+        mv 'output/positionalConsensus*' '$consensus_posi' 
+    ]]></command>
+    <inputs>
+        <param name="input_file" type="data" format="fasta" label="Input miRNA file"/>
+        <param name="utr_file" type="data" format="fasta" label="Input UTR file"/>
+        <param name="programs" type="select" multiple="true" optional="false" label="Select at least one prediction program">
+            <option value="TAPIR_FASTA" selected="true">Tapir (fasta)</option>
+            <option value="TAPIR_HYBRID">Tapir (hybrid)</option>
+            <option value="PSROBOT">Psrobot</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data name="consensus" format="txt" from_work_dir="output/consensus.txt" label="${tool.name} on ${on_string}: consensus file"/>
+        <data name="consensus_multi" format="txt" label="${tool.name} on ${on_string}: consensus file (multiple target)"/>
+        <data name="consensus_transcript" format="txt" label="${tool.name} on ${on_string}: consensus file (transcript target)"/>
+        <data name="consensus_posi" format="txt" label="${tool.name} on ${on_string}: consensus file (positional target)"/>
+        <data name="tapir_fasta" format="txt" from_work_dir="outputs/TAPIR_FASTA.txt" label="${tool.name} on ${on_string}: TAPIR_FASTA file">
+            <filter>programs and "TAPIR_FASTA" in programs</filter>
+        </data>
+        <data name="tapir_hybrid" format="txt" from_work_dir="outputs/TAPIR_HYBRID.txt" label="${tool.name} on ${on_string}: TAPIR_HYBRID file">
+            <filter>programs and "TAPIR_HYBRID" in programs</filter>
+        </data>
+        <data name="psrobot" format="txt" from_work_dir="outputs/PSROBOT.txt" label="${tool.name} on ${on_string}: PSROBOT file">
+            <filter>programs and "PSROBOT" in programs</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test expect_num_outputs="5">
+            <param name="input_file" value="plant_mirnas_test.fa" ftype="fasta"/>
+            <param name="utr_file" value="plant_targets_test.fa" ftype="fasta"/>
+            <param name="programs" value="PSROBOT"/>
+        </test>
+        <test expect_num_outputs="7">
+            <param name="input_file" value="plant_mirnas_test.fa" ftype="fasta"/>
+            <param name="utr_file" value="plant_targets_test.fa" ftype="fasta"/>
+            <param name="programs" value="TAPIR_FASTA,TAPIR_HYBRID,PSROBOT"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+        **What does this tool**
+
+        This tool runs multiple animal miRNA target-prediction methods and produce a consensus prediction then.
+
+        **Input**
+
+        - miRNA file (fasta format)
+        - UTR/target file (fasta format)
+
+        **Outputs**
+
+        - Consensus files (multiple targets, per transcript and positional consensus)
+        - for each method a separated file with information
+
+    ]]></help>
+    <expand macro="citations"/>
+</tool>
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/srnablast.xml b/tools/rna_tools/srnatoolbox/srnablast.xml
new file mode 100644
index 0000000000..df41b93057
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/srnablast.xml
@@ -0,0 +1,68 @@
+<tool id="srnablast" name="sRNAtoolbox: sRNAblast" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>identifies the potential origin of small RNA reads</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command><![CDATA[
+
+        mkdir outputs &&
+
+        #set $file = re.sub('[^\w\-_\.]', '_', $input_file.element_identifier)
+        ls -s '$input_file' '$file' &&
+
+        /srv/bin/sRNAblast
+        input='$file'
+        output='outputs'
+        maxReads=${maxReads}
+        blastDB='$blastDB'
+        minIdent=${minIdent}
+        maxEvalue=${maxEvalue}
+        
+    ]]></command>
+    <inputs>
+        <param name="input_file" type="data" format="fasta,fastq" label="Insert input file"/>
+        <param name="maxReads" type="integer" value="500" label="Set top n reads" help="The number of top expressed reads that we will be blasted by blast"/>
+        <param name="blastDB" type="select" label="Select blast DB">
+            <option value="nr" selected="true">nr</option>
+        </param>
+        <param name="minIdent" type="integer" value="90" label="The minimum identity for a blast result"/>
+        <param name="maxEvalue" type="integer" value="2" label="The maximum E-value"/> 
+    </inputs>
+    <outputs>
+        <data name="read_analysis" format="txt" from_work_dir="outputs/stat/readLengthAnalysis.txt" label="${tool.name} on ${on_string}: Read length analysis"/>
+        <data name="read_full" format="txt" from_work_dir="outputs/stat/readLengthFull.txt" label="${tool.name} on ${on_string}: Read length full"/>
+        <data name="blast" format="tabular" from_work_dir="outputs/blast.out" label="${tool.name} on ${on_string}: BLAST output"/>
+        <data name="reads_origin"  format="fasta" from_work_dir="outputs/reads_orig.fa" label="${tool.name} on ${on_string}: Reads origin"/>
+        <data name="reads" format="fasta" from_work_dir="outputs/reads.fa" label="${tool.name} on ${on_string}: Reads" />
+        <data name="short_reads" format="txt" from_work_dir="outputs/short_reads.txt" label="${tool.name} on ${on_string}: Short reads"/>
+        <data name="blast_species" format="tabular" from_work_dir="outputs/species.out" label="${tool.name} on ${on_string}: BLAST species"/>
+        <data name="blast_speciesSa" format="tabular" from_work_dir="outputs/speciesSa.out" label="${tool.name} on ${on_string}: BLAST speciesSa"/>
+        <data name="blast_taxo" format="tabular" from_work_dir="outputs/tax.out" label="${tool.name} on ${on_string}: BLAST taxonomy"/>  
+    </outputs>
+    <tests>
+        <test expect_failure="true">
+            <param name="input_file" value="srnablast_test.fa" ftype="fasta"/>
+        </test>
+        <test expect_num_outputs="9">
+            <param name="input_file" value="srnablast_test.fatsq" ftype="fastq"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+        
+        **What does this tool do**
+
+        sRNAblast identifies the potential origin of small RNA reads by performing BLAST searches against a nucleotide sequence database and summarizing the resulting taxonomic and species assignments.
+
+        **Input**
+
+        - Fasta or Fastq file with small RNA reads
+
+        **Outputs**
+
+        - BLAST outputs
+        - Processed read informations
+
+    ]]></help>
+    <expand macro="citations"/>
+</tool>
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/test-data/mirnas_test.fa b/tools/rna_tools/srnatoolbox/test-data/mirnas_test.fa
new file mode 100644
index 0000000000..b34c9ea9b3
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/test-data/mirnas_test.fa
@@ -0,0 +1,6 @@
+>test_miR_1
+UGAGGUAGUAGGUUGUAUAGUU
+>test_miR_2
+UAGCAGCACGUAAAUAUUGGCG
+>test_miR_3
+UGGAAUGUAAAGAAGUAUGUAU
diff --git a/tools/rna_tools/srnatoolbox/test-data/plant_mirnas_test.fa b/tools/rna_tools/srnatoolbox/test-data/plant_mirnas_test.fa
new file mode 100644
index 0000000000..6bff57b5fa
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/test-data/plant_mirnas_test.fa
@@ -0,0 +1,6 @@
+>plant_miR_test_1
+UGACAGAAGAGAGUGAGCAC
+>plant_miR_test_2
+UUGACAGAAGAUAGAGAGCAC
+>plant_miR_test_3
+UGAAGCUGCCAGCAUGAUCUA
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/test-data/plant_targets_test.fa b/tools/rna_tools/srnatoolbox/test-data/plant_targets_test.fa
new file mode 100644
index 0000000000..4da57eb5b5
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/test-data/plant_targets_test.fa
@@ -0,0 +1,8 @@
+>plant_target_test_1
+ATGCGTACGATCGATGCTAGCTAGCTAACGGTGCTCACTCTCTTCTGTCAGCTAGCATCGATCGATGCTAGCTAGCATCG
+>plant_target_test_2
+CGATCGTAGCTAGCATCGATGCTAACGTAGGTGCTCTCTATCTTCTGTCAAGATCGATGCTAGCTAGCATCGATCGTAGCTA
+>plant_target_test_3
+GCTAACGATCGATGCTAGCATCGATCGTAGTAGATCATGCTGGCAGCTTCACGATCGTAGCATGCTAGCTAACGATCGATC
+>plant_target_negative_control
+ATGCGATCGATCGTAGCTAGCTAACGATCGGCTAGCTAGCATCGATCGATGCTAGCTAACG
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/test-data/srnablast_test.fa b/tools/rna_tools/srnatoolbox/test-data/srnablast_test.fa
new file mode 100644
index 0000000000..aefe6020c3
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/test-data/srnablast_test.fa
@@ -0,0 +1,30 @@
+>read_001
+UGAGGUAGUAGGUUGUAUAGUU
+>read_002
+UGAGGUAGUAGGUUGUAUAGUU
+>read_003
+UGAGGUAGUAGGUUGUAUAGUU
+>read_004
+UAGCAGCACGUAAAUAUUGGCG
+>read_005
+UAGCAGCACGUAAAUAUUGGCG
+>read_006
+UGGAAUGUAAAGAAGUAUGUAU
+>read_007
+UGGAAUGUAAAGAAGUAUGUAU
+>read_008
+UGGAAUGUAAAGAAGUAUGUAU
+>read_009
+UGGAAUGUAAAGAAGUAUGUAU
+>read_010
+UGAGGUAGUAGGUUGUAUAGUU
+>read_011
+UCACCGGGUGUAAAUCAGCUUG
+>read_012
+UAAAGUGCUGACAGUGCAGAU
+>read_013
+UGACCUAUGAAUUGACAGCC
+>read_014
+ACUGGACUUGGAGUCAGAAGGC
+>read_015
+CGUACGCGGAAUACUUCGA
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/test-data/srnablast_test.fastq b/tools/rna_tools/srnatoolbox/test-data/srnablast_test.fastq
new file mode 100644
index 0000000000..82c3f1ed83
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/test-data/srnablast_test.fastq
@@ -0,0 +1,40 @@
+@read_001
+UGAGGUAGUAGGUUGUAUAGUU
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_002
+UGAGGUAGUAGGUUGUAUAGUU
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_003
+UGAGGUAGUAGGUUGUAUAGUU
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_004
+UAGCAGCACGUAAAUAUUGGCG
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_005
+UAGCAGCACGUAAAUAUUGGCG
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_006
+UGGAAUGUAAAGAAGUAUGUAU
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_007
+UGGAAUGUAAAGAAGUAUGUAU
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_008
+UGGAAUGUAAAGAAGUAUGUAU
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_009
+UCACCGGGUGUAAAUCAGCUUG
++
+IIIIIIIIIIIIIIIIIIIIII
+@read_010
+UAAAGUGCUGACAGUGCAGAU
++
+IIIIIIIIIIIIIIIIIIIII
\ No newline at end of file
diff --git a/tools/rna_tools/srnatoolbox/test-data/utr_test.fa b/tools/rna_tools/srnatoolbox/test-data/utr_test.fa
new file mode 100644
index 0000000000..cbbf3b7288
--- /dev/null
+++ b/tools/rna_tools/srnatoolbox/test-data/utr_test.fa
@@ -0,0 +1,8 @@
+>target_1_seed_test_miR_1
+ATGCGTACGTTAGCTAGCTAACGATCGATCTACCTCTTCGATCGATGCTAGCTAGCTAACGTAGC
+>target_2_seed_test_miR_2
+CGATCGGATCCGATGCTAACGTTAGCTATGCTGCTGATCGATCGTAGCTAGCTACGATCGATCG
+>target_3_seed_test_miR_3
+GCTAGCATCGATCGTTAGCTACGATCGAACATTCCCGATGCTAGCTAGCATCGATCGATCGATC
+>target_4_negative_control
+AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTACACACACACGTGTGTGTGTG
\ No newline at end of file