diff --git a/L2022112452_17_Test.java b/L2022112452_17_Test.java
index f0866ba..c9f6d69 100644
--- a/L2022112452_17_Test.java
+++ b/L2022112452_17_Test.java
@@ -1,72 +1,74 @@
-import org.junit.jupiter.api.Test;
-
-import java.util.ArrayList;
-import java.util.Collections;
-import java.util.List;
-
-import static org.junit.jupiter.api.Assertions.*;
-
-class L2022112452_17_Test {
-
-    @Test
-    void testFindRepeatedDnaSequences() {
-        Solution1 sol = new Solution1();
-
-        // Test case 1: General case with multiple repeated sequences
-        String input1 = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT";
-        List<String> expected1 = new ArrayList<>();
-        expected1.add("AAAAACCCCC");
-        expected1.add("CCCCCAAAAA");
-        List<String> output1 = sol.findRepeatedDnaSequences(input1);
-        assertTrue(compareLists(output1, expected1), "Test case 1 failed.");
-
-        // Test case 2: All characters are the same, only one repeated sequence
-        String input2 = "AAAAAAAAAAAAA";
-        List<String> expected2 = new ArrayList<>();
-        expected2.add("AAAAAAAAAA");
-        List<String> output2 = sol.findRepeatedDnaSequences(input2);
-        assertTrue(compareLists(output2, expected2), "Test case 2 failed.");
-
-        // Test case 3: No repeated sequences
-        String input3 = "ACGTACGTAC";
-        List<String> expected3 = Collections.emptyList();
-        List<String> output3 = sol.findRepeatedDnaSequences(input3);
-        assertTrue(compareLists(output3, expected3), "Test case 3 failed.");
-
-        // Test case 4: Input string shorter than 10 characters
-        String input4 = "ACGT";
-        List<String> expected4 = Collections.emptyList();
-        List<String> output4 = sol.findRepeatedDnaSequences(input4);
-        assertTrue(compareLists(output4, expected4), "Test case 4 failed.");
-
-        // Test case 5: Input string exactly 10 characters with no repeats
-        String input5 = "ACGTACGTAG";
-        List<String> expected5 = Collections.emptyList();
-        List<String> output5 = sol.findRepeatedDnaSequences(input5);
-        assertTrue(compareLists(output5, expected5), "Test case 5 failed.");
-
-        // Test case 6: Edge case, input string exactly 10 characters, with repeats
-        String input6 = "ACGTACGTAC";
-        List<String> expected6 = Collections.emptyList(); // No repetition
-        List<String> output6 = sol.findRepeatedDnaSequences(input6);
-        assertTrue(compareLists(output6, expected6), "Test case 6 failed.");
-    }
-
-    /**
-     * Helper method to compare two lists regardless of order.
-     *
-     * @param list1 First list.
-     * @param list2 Second list.
-     * @return True if both lists contain the same elements, regardless of order.
-     */
-    private boolean compareLists(List<String> list1, List<String> list2) {
-        if (list1.size() != list2.size()) {
-            return false;
-        }
-        List<String> temp1 = new ArrayList<>(list1);
-        List<String> temp2 = new ArrayList<>(list2);
-        Collections.sort(temp1);
-        Collections.sort(temp2);
-        return temp1.equals(temp2);
-    }
-}
+import org.junit.jupiter.api.Test;
+
+import java.util.ArrayList;
+import java.util.Collections;
+import java.util.List;
+import static org.junit.jupiter.api.Assertions.*;
+/**
+ * lhx:测试用例合理且充足，写的挺不错的。
+ */
+
+class L2022112452_17_Test {
+
+    @Test
+    void testFindRepeatedDnaSequences() {
+        Solution1 sol = new Solution1();
+
+        // Test case 1: General case with multiple repeated sequences
+        String input1 = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT";
+        List<String> expected1 = new ArrayList<>();
+        expected1.add("AAAAACCCCC");
+        expected1.add("CCCCCAAAAA");
+        List<String> output1 = sol.findRepeatedDnaSequences(input1);
+        assertTrue(compareLists(output1, expected1), "Test case 1 failed.");
+
+        // Test case 2: All characters are the same, only one repeated sequence
+        String input2 = "AAAAAAAAAAAAA";
+        List<String> expected2 = new ArrayList<>();
+        expected2.add("AAAAAAAAAA");
+        List<String> output2 = sol.findRepeatedDnaSequences(input2);
+        assertTrue(compareLists(output2, expected2), "Test case 2 failed.");
+
+        // Test case 3: No repeated sequences
+        String input3 = "ACGTACGTAC";
+        List<String> expected3 = Collections.emptyList();
+        List<String> output3 = sol.findRepeatedDnaSequences(input3);
+        assertTrue(compareLists(output3, expected3), "Test case 3 failed.");
+
+        // Test case 4: Input string shorter than 10 characters
+        String input4 = "ACGT";
+        List<String> expected4 = Collections.emptyList();
+        List<String> output4 = sol.findRepeatedDnaSequences(input4);
+        assertTrue(compareLists(output4, expected4), "Test case 4 failed.");
+
+        // Test case 5: Input string exactly 10 characters with no repeats
+        String input5 = "ACGTACGTAG";
+        List<String> expected5 = Collections.emptyList();
+        List<String> output5 = sol.findRepeatedDnaSequences(input5);
+        assertTrue(compareLists(output5, expected5), "Test case 5 failed.");
+
+        // Test case 6: Edge case, input string exactly 10 characters, with repeats
+        String input6 = "ACGTACGTAC";
+        List<String> expected6 = Collections.emptyList(); // No repetition
+        List<String> output6 = sol.findRepeatedDnaSequences(input6);
+        assertTrue(compareLists(output6, expected6), "Test case 6 failed.");
+    }
+
+    /**
+     * Helper method to compare two lists regardless of order.
+     *
+     * @param list1 First list.
+     * @param list2 Second list.
+     * @return True if both lists contain the same elements, regardless of order.
+     */
+    private boolean compareLists(List<String> list1, List<String> list2) {
+        if (list1.size() != list2.size()) {
+            return false;
+        }
+        List<String> temp1 = new ArrayList<>(list1);
+        List<String> temp2 = new ArrayList<>(list2);
+        Collections.sort(temp1);
+        Collections.sort(temp2);
+        return temp1.equals(temp2);
+    }
+}