-
Go to GitHub and create a free accout.
-
Look back at the notes and create your SSH key and add it to your github account. Notes for key creation
$ ssh-keygen -t ed25519 -C "your_email@example.com"
> Enter a file in which to save the key (/Users/YOU/.ssh/id_ALGORITHM: [Press enter]
> Enter passphrase (empty for no passphrase): [Type a passphrase]
> Enter same passphrase again: [Type passphrase again]
$ eval "$(ssh-agent -s)"
> Agent pid 59566
$ vi ~/.ssh/config
Host *
IdentityFile ~/.ssh/id_ed25519
Paste the contents of your public "Lock" to GitHub with a title
cat ~/.ssh/id_ed25519.pub
-
Create your first repository for your problem set code. Notes for repository creation. NOTE: Don't create a repository inside of another repostitory.
- Create a new Repository by clicking "New" on the repository github page. https://github.com/YOURUSERNAME/repositories
- Create a local (your machine) directory with
mkdir <dirname> - move into the new directory with
cd <dirname> - start setting up your repository with the code produced by github. Start with
git init. - Don't
git initin your home directory. Make a new directory (something like pfb_problemsets or problemsets or problem_sets), change directory into the new directory, thengit init - Now link it to your remote repository with
git remote add.
-
Move any files you created in Unix_01 Problem set to your local problemset git repository.
-
Push all the new files in your local repository to your remote repository
git statusto see all the files you need to addgit add <filename>orgit add <filename1> <filename2> <filename3> ...git commit -m 'adding previous problem set files'git push- Visit the your GitHub repository website (on github.com) and see the files from your local repository that you just pushed up to your remote repository.
-
Create a directory call
filesin your ProblemSets directory. -
Move the file you renamed from
sequences.nt.fatocancer_genes.fastato yourfilesdirectory -
ADD/COMMIT/PUSH
cancer_genes.fastato your remote repository
git add files/cancer_genes.fastagit commit -m 'adding cancer_genes.fasta'git push- Visit the your GitHub repository website (on github.com) and see the file from your local repository that you just pushed up to your remote repository.
- Using your vi text editor create a fasta file and name it
mysequences.txt. Make sure it ends up in your problem sets files directory.
This is fasta file format:
>seqName description
ATGGCGTCTTGGCCTTAAAAGCTC
GGCGTCTTGGCCTTAAAAGCTCAT
ATTCTTGGCCTTAAATTGGCCTTG
- add 10 lines of sequence
- delete a line
- insert a new line at line 4
- Copy line 5
- Paste this line above line 2
- set to view line numbers
- Cut line 3 and paste below line 6
- Go to line 4
- delete a line
- undo your last delete
- search for
CTT - find next occurance of
CTT - Save and exit
-
ADD/COMMIT/PUSH
mysequences.txtto your remote. -
Create a directory called
fastas. (Hint: use mkdir) -
Copy the fasta file that you renamed to
cancer_genes.fastato the fasta directory. -
Verify that the file is within the fasta directory.
-
Delete the the original file that you used for copying.
-
Sync your remote repo with your local repo. Make sure to add each file you changed or use
git add <filename>. Don't forget to commit and push. -
Practice with
git rm
- Create a file named
oopsand add a few characters of content. - Save and Exit.
- Add/Commit/Push this file
git rm oopsgit commit -m 'removing oops'git push
- Practice with
rm. Can you spot the little difference fromgit rm
- Create a file named
oops2. add some content. save and exit - Add/Commit/Push this file
rm oops2git add oops2git commit -m 'removing oops2'git push
- Imagine this: You created a file,
git addit, but then realize you don't want to commit it. What do you do? from google search
- Create a file named
never. git add nevergit reset never
- Read the man page for
rmandcpto find out how to remove and copy a directory. - Print out your history and redirect it to a file called
unixBasics.history.txt - Open your history file with your text editor and delete any lines you do not want to keep. See this google search for info on deleting entire lines in vi.
- Make sure all your files are synced with your remote repository. (
git status)