This repository demonstrates finetuning generalist seq2func models (here AlphaGenome & Enformer) on MPRA (Massively Parallel Reporter Assay) and STARR-seq data. The modular approach shown here can be applied to any generalist seq2func model that provides sequence embeddings, making it a flexible framework for regulatory sequence prediction tasks.
The goal is to think of any pretrained generalist model as modular components that can be used separately for their cis-regulatory logic. Here we finetuned the generalists' encoders to predict reporter activity from genomic sequences, applying it to lentiMPRA and DeepSTARR datasets and evaluating performance zero-shot on CAGI5 data.
This approach leverages the rich sequence representations learned by large-scale generalist models while adapting them to specific regulatory tasks through task-specific prediction heads.
- For AlphaGenome models: Install AlphaGenome Research:
pip install git+https://github.com/google-deepmind/alphagenome_research.git- For Enformer models: Install Enformer PyTorch:
pip install enformer-pytorch- Install this project:
git clone https://github.com/Al-Murphy/alphagenome_FT_MPRA.git
cd alphagenome_FT_MPRA
pip install -e .This will automatically install the alphagenome-ft package as a dependency (for AlphaGenome models) and other required packages.
- Overview
- Code Guides
This project demonstrates a modular approach to using generalist seq2func models:
DNA Sequence (B, S, 4)
↓
Generalist Model Backbone (frozen)
├── AlphaGenome: Encoder → Transformer → Decoder
├── Enformer: Convolutional blocks → Transformer → Output heads
└── Other seq2func models...
↓
Sequence Embeddings (extracted from backbone)
├── High-resolution embeddings (1bp)
├── Low-resolution embeddings (128bp)
└── Architecture-specific features
↓
Custom Task-Specific Heads (trainable)
├── MPRAHead: Reporter activity prediction
├── DeepSTARRHead: Enhancer activity prediction
└── YOUR_CUSTOM_HEAD ← Add here
-
AlphaGenome:
- Multi-resolution embeddings (1bp, 128bp, pairwise)
- Uses
alphagenome-ftfor finetuning utilities - See that repository for documentation on custom heads, parameter freezing, and model wrapping
-
Enformer:
- Encoder-level embeddings at 128bp resolution
- PyTorch implementation with custom heads
- See
alphagenome_ft_mpra/enf_utils.pyfor Enformer-specific utilities
-
Other Generalist Models:
- The modular approach can be extended to any seq2func model
- Key requirement: ability to extract sequence embeddings from the backbone
- Custom heads can be implemented following the same pattern
- Backbone: Held fixed during training via Optax optimizer masking in
alphagenome-ft(not onlystop_gradienton parameters). Callfreeze_except_head(...)before training so the default training loop uses a heads-only optimizer. - Embeddings: Extract multi-resolution sequence representations
- Heads: Train task-specific prediction layers on top of frozen embeddings
This approach allows leveraging rich pretrained representations while efficiently adapting to new tasks.
import jax
import jax.numpy as jnp
from alphagenome_research.model import dna_model
from alphagenome.models import dna_output
from alphagenome_ft import (
CustomHead,
HeadConfig,
HeadType,
register_custom_head,
wrap_pretrained_model,
add_custom_heads_to_model,
)
from alphagenome_ft_mpra.mpra_heads import MPRAHead
# 1. Register custom MPRA head
register_custom_head(
'mpra_head',
MPRAHead,
HeadConfig(
type=HeadType.GENOME_TRACKS,
name='mpra_head',
output_type=dna_output.OutputType.RNA_SEQ,
num_tracks=1,
metadata={'center_bp': 128, 'pooling_type': 'flatten', 'embedding_mode': '1bp'}
)
)
# 2. Load pretrained model and add MPRA head
base_model = dna_model.create_from_kaggle('all_folds')
model = wrap_pretrained_model(base_model)
model = add_custom_heads_to_model(model, custom_heads=['mpra_head'])
# 3. Mark head-only finetuning (backbone fixed during training)
model.freeze_except_head('mpra_head') # sets optimizer hint; see alphagenome-ft docs
# 4. Train on your MPRA data (training uses alphagenome_ft.optimizer_utils masking)
# See scripts/finetune_mpra.py for complete training exampleimport torch
from enformer_pytorch import from_pretrained
from alphagenome_ft_mpra.enf_utils import EncoderMPRAHead
# 1. Load pretrained Enformer
enformer = from_pretrained('EleutherAI/enformer-official-rough', use_tf_gamma=False)
# 2. Create model with custom MPRA head
model = EncoderMPRAHead(
enformer=enformer,
num_tracks=1,
center_bp=256,
pooling_type='sum'
)
# 3. Freeze Enformer backbone (only train head)
model.freeze_backbone()
# 4. Train on your MPRA data
# See scripts/finetune_enformer_mpra.py for complete training exampleYou can also use the pretrained model as an oracle. Currently, MPRAOracle is only supported.
from alphagenome_ft_mpra import load_oracle
oracle = load_oracle(
"/path/to/checkpoint_dir",
# Optional construct pieces (set to None to skip)
left_adapter=None,
right_adapter=None,
promoter="TCCATTATATACCCTCTAGTGTCGGTTCACGCAATG",
barcode="AGAGACTGAGGCCAC",
)
# mode="core": add left/right adapters + promoter + barcode (if provided)
# mode="flanked": add promoter + barcode (if provided)
# mode="full": no sequence additions
# Usage 1) onehot in shape: (S, 4) or (B, S, 4)
scores = oracle.predict(onehot, mode="core")
# Usage 2) string convenience wrapper
scores = oracle.predict_sequences(["ACGT..."], mode="core")For both AlphaGenome and Enformer, you can use pre-configured hyperparameters:
# AlphaGenome with LentiMPRA
python scripts/finetune_mpra.py --config configs/mpra_HepG2.json
# Enformer with LentiMPRA
python scripts/finetune_enformer_mpra.py --config configs/mpra_HepG2.json
# AlphaGenome with DeepSTARR
python scripts/finetune_starrseq.py --config configs/starrseq.json
# Enformer with DeepSTARR
python scripts/finetune_enformer_starrseq.py --config configs/starrseq.jsonalphagenome_FT_MPRA/
├── alphagenome_ft_mpra/ # Source code
│ ├── mpra_heads.py # Custom prediction heads (MPRAHead, EncoderMPRAHead, DeepSTARRHead)
│ ├── enf_utils.py # Enformer-specific utilities and heads
│ ├── data.py # Data loading classes (LentiMPRADataset, DeepSTARRDataset)
│ ├── seq_loader.py # Sequence loading utilities
│ ├── training.py # Training utilities and helpers
│ ├── oracle.py # MPRA oracle loading + predict(onehot, mode=...) and predict_sequence(...)
│ └── __init__.py
├── scripts/ # Executable training and evaluation scripts
│ ├── finetune_mpra.py # Finetune AlphaGenome on LentiMPRA
│ ├── finetune_enformer_mpra.py # Finetune Enformer on LentiMPRA
│ ├── finetune_starrseq.py # Finetune AlphaGenome on DeepSTARR
│ ├── finetune_enformer_starrseq.py # Finetune Enformer on DeepSTARR
│ ├── test_ft_model_*.py # Evaluation scripts for finetuned models
│ ├── test_cagi5_zero_shot_*.py # Zero-shot evaluation on CAGI5 benchmark
│ ├── compute_attributions_lentimpra.py # Attribution analysis (DeepSHAP, gradients)
│ ├── compute_attributions_starrseq.py # Attribution analysis (DeepSHAP, gradients)
│ ├── cache_embeddings.py # Pre-compute embeddings for faster training
│ ├── create_mpra_comparison_table.py # Generate performance comparison tables
│ └── README.md # Script documentation
├── configs/ # Hyperparameter configuration files
│ ├── mpra_HepG2.json # Optimal config for HepG2 cell line
│ ├── mpra_K562.json # Optimal config for K562 cell line
│ ├── mpra_WTC11.json # Optimal config for WTC11 cell line
│ ├── starrseq.json # Optimal config for DeepSTARR dataset
│ └── README.md # Config file documentation
├── data/ # Datasets
│ ├── legnet_lentimpra/ # LentiMPRA training data
│ ├── deepstarr/ # DeepSTARR dataset
│ ├── cagi5/ # CAGI5 benchmark data
│ └── motifs/ # Motif analysis data
├── results/ # Training outputs and evaluations
│ ├── models/ # Saved model checkpoints
│ ├── benchmark_*.csv # Benchmark results
│ ├── plots/ # Generated plots and figures
│ └── mpralegnet_predictions/ # LegNet baseline predictions
├── assets/ # Images and figures
│ └── images/
│ └── modular_generalists.png
├── test.ipynb # Example notebook
├── main.py # Entry point
├── pyproject.toml # Project dependencies
└── README.md # This file
- Model-Agnostic Design: Works with any generalist seq2func model (AlphaGenome, Enformer, etc.)
- Modular Architecture: Separate frozen backbones from trainable task-specific heads
- Multiple Datasets: Support for LentiMPRA (multiple cell lines) and DeepSTARR
- Flexible Embedding Access: Use different resolution embeddings (1bp, 128bp, encoder-only)
- Two-Stage Training: Optional cached-embedding training for faster iteration
- Comprehensive Evaluation: Zero-shot benchmarks, attribution analysis, and comparison tables
- Production-Ready Configs: Pre-optimized hyperparameters for each dataset/cell line
To add support for another generalist seq2func model:
- Extract Embeddings: Implement a function to extract sequence embeddings from your model
- Create Custom Head: Implement a head class (see
alphagenome_ft_mpra/mpra_heads.pyfor examples) - Wrap Model: Create a wrapper that freezes the backbone and exposes embeddings
- Add Training Script: Follow the pattern in
scripts/finetune_*.py
The key principle is: freeze the generalist backbone, train only the task-specific head.
This project extends AlphaGenome and uses Enformer. Please refer to the original licenses:
- AlphaGenome: See AlphaGenome Research license
- Enformer: See Enformer license
