Skip to content
Open
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension


Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
144 changes: 16 additions & 128 deletions README.md
Original file line number Diff line number Diff line change
@@ -1,143 +1,31 @@
# my_first_tool
**This program consists of 3 tools:**
**This program consists several of my homeworks:**
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

В целом для внешних людей чтобы лучше понимали что происходит можно добавить что это годовая программа ИБ и курс по питону

## Main script
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Тут то что main в целом ок, хотя можно было бы дать название главному скрипту такое же как название репозитория

**Main.py** consists of several tools in the form of
1) functions:
- 'dna_rna_tools' - List of procedures: `transcribe` (return the transcribed sequence), `reverse` (return the reversed sequence), `complement` (return the complementary sequence), `reverse_complement` (return the reverse complementary sequence);
- 'protein_tools'- List of procedures: `length` (return the number of amino acids in protein sequence(s)), `percentage` (return percentage of each amino acid in sequence), `pattern` (return all non-overlaping instances of a given pattern in sequences), `3Letter_name` (return three-letter amino acids into a three-letter amino acids), `DNA_code` ( return transformed protein sequence(s) to DNA sequence(s)), `fastq_tools` (return percentage of each amino acid in sequence);
- 'fastq_tools' - Procedure: filtering of the dictionary of sequences by the length, quality of sequencing of each nucleotides and GC% content.
- 'protein_tools'- List of procedures: `length` (return the number of amino acids in protein sequence(s)), `percentage` (return percentage of each amino acid in sequence), `pattern` (return all non-overlaping instances of a given pattern in sequences), `3Letter_name` (return three-letter amino acids into a three-letter amino acids), `DNA_code` ( return transformed protein sequence(s) to DNA sequence(s)),
2) Class with using BioPython:
- 'filter_fastq'- Procedure: filtering of the dictionary of sequences by the length, quality of sequencing of each nucleotides and GC% content.

## run_dna_rna_tools.py
> *description of how the run_dna_rna_tools.py program works*
Also here You can find abbility to fork with API and telegramm_bot

This program contains the function `run_dna_rna_tools`. The `run_dna_rna_tools` function takes as input an arbitrary number of arguments containing DNA or RNA sequences in the form (*str*), as well as the name of the procedure to be performed, specified as the last argument. After this, the command performs the specified action on all transmitted sequences. If one sequence is supplied, a string with the result is returned. If several are submitted, a list of strings is returned.

**Use example**
```python
run_dna_rna_tools('ATG', 'transcribe') # 'AUG'
run_dna_rna_tools('ATG', 'reverse') # 'GTA'
run_dna_rna_tools('AtG', 'complement') # 'TaC'
run_dna_rna_tools('ATg', 'reverse_complement') # 'cAT'
run_dna_rna_tools('ATG', 'aT', 'reverse') # ['GTA', 'Ta']
```
## bio_files_processor
**bio_files_processor.py** consists of function for converting multiline fasta to one line fasta.

## protein_tools.py
> *Discription how the protein_tools.py works:*
This program contains the function `protein_tool`. The `protein_tool` function takes as input an arbitrary number of arguments in the form of amino acid (aa)/protein sequences of type *str*, as well as the name for the procedure to be performed. After this, the function performs the specified action on all provided sequences. Carefully read the rules of usage for each option, because they specify correct ways of entering arguments, as well as the output and the type of data in the output.
### :warning: Attention: 1) The programm is register-dependent; 2) Before using some of the options read 'Procedures description' carefully. 3) If you input sequenses or 'options' incorrectly, the program will provide you with helpful error messages.
## custom_random_forest
**custom_random_forest.py** consists of custom Class for creating CustomRandomForest but instead of usual RandomForest from sklearn library it has abbility for parallel work.

***compare***
**Introduction**
The **compare** procedure compares the first amino acid sequence provided with the following ones.
***Inputs***
To start using the length procedure, enter sevreal arguments:
- _an arbitrary number_ of sequences, where the first sequence is a reference to which the following sequences are compared; each argument should be of type 'str'.
- _second-to-last_ argument is the number of decimals to round the number to; type 'int'
- _last_ argument determines whether percentages are returned instead of fractions; type 'bool'
**Outputs**
It returns a 'dict' object where:
- *keys* are compared-to sequences (type str)
- *values* are either fractions or percentages (type float).
**Usage example**
```python
protein_tool('LAlLAlwWGPdPA', 'LAlLAl', 3, False, options = 'compare') # {'LAlLAl': 1.0}
protein_tool('LAlLAlwWGPdPA', 'LAlLAl', 'GPdPA', 3, True, options = 'compare')) # {'LAlLAl': 100.0, 'GPdPA': 20.0}
```
## test_my_first_tool
**test_my_first_tool.py** consist of tests for chaking mistakes in the code and several processes

***length***
**Introduction**
The **length** procedure calculates the length of protein sequence(s) (equal to the number of amino acids).
**Inputs**
To start using the length procedure, enter one or more protein sequences for which you want to get a summary, and at the end add `options = ‘length’`.
**Outputs**
The result of the procedure is a list with the numbers of amino acids in each sequence. The list contains only numbers of amico acids in the sequence.
**Usage example***
```python
protein_tool('LAlLAlwWGPdPA', options = 'length') # [13]
protein_tool('RRRrrrR', 'WGPdPA', 'LAlLAlw', options = 'length') # [7, 6, 7]
```
## Showcases.ipynb
**Showcases.ipynb** consist of showing how the CustomRandomForest work

***percentage***
**Introduction**
The **percentage** procedure calculates the percentage of all 20 proteinogenic amino acid residues, case-sensitive in the protein sequences
**Input**
To start using the count_percentage procedure, enter one or more protein sequences for which you want to get a summary, and at the end add `options = ‘percentage’`.
**Outputs**
The result of the procedure is a list of dictionaries with the percentages of the corresponding amino acids in each sequence. The dictionary contains only amino acid residues whose percentage in the sequence is not equal to 0 (which are contained in the sequence at all). Also, the dictionary is ordered from the largest percentage of content to the smallest. Cases of amino acid residues are taken into account.
> :warning: Attention: We use rounding to 2 decimal places. In some cases, **the sum of percentages** of all amino acid residues for sequence **may not be exactly 100%** due to rounding.
**Usage example**
```python
protein_tool('LAlLAlwWGPdPA', options = 'percentage') # [{'A': 23.08, 'L': 15.38, 'l': 15.38, 'P': 15.38, 'w': 7.69, 'W': 7.69, 'G': 7.69, 'd': 7.69}]
protein_tool('RRRrrrR', 'WGPdPA', 'LAlLAlw', options = 'percentage') # [{'R': 57.14, 'r': 42.86}, {'P': 33.33, 'W': 16.67, 'G': 16.67, 'd': 16.67, 'A': 16.67}, {'L': 28.57, 'A': 28.57, 'l': 28.57, 'w': 14.29}]
```

***pattern***
**Introduction**
The **pattern** procedure finds all non-overlaping cases of a given pattern in amino acid sequence(s) provided.
**Inputs**
To start using the pattern procedure, enter one or more protein sequences for which you want to get a summary, where the first sequence is a pattern, which is searched for in the following sequences; each argument should be of type 'str' and at the end add `options = ‘pattern’`.
The *find_pattern()* function goes through a sequence in the following way: it takes a subsequence of amino acids in front of an index equal in length to the pattern and compares it to the pattern. If there is no match, index is moved one amino acid to the end of the sequence. If there is a match, the index is saved, and the function jumps to an aminoacid next to the end of the subsequence, then the algorithm repeats. Comparison is performed by *compare_pattern* subfunction.
The image explanation of that function.
![The image explanation of that function **pattern**](https://github.com/GlebBobkov/HW4_Bobkov/raw/HW4_Bobkov/HW4_Bobkov/explanation.jpg)

**Outputs**
The result of this procedure is a 'dict' object where:
- *keys* are amino acid sequences (type 'str')
- _values_ are lists where the first element is a number of pattern instances in a given sequence, and the following elements are indexes of these occurances
**Usage example**
```python
protein_tool('LAlLAlwWGPdPA', 'LAlLAl', 'GPdPA', options = 'pattern') # {'LAlLAl': [2, 0, 3], 'GPdPA': [0]}
protein_tool('LAlLAlwWGPdPA', 'AlLAl', options = 'pattern') # {'AlLAl': [1, 2]}
```

***3Letter_name***
**Introduction**
The **3Letter_name** procedure transforms one-letter amino acid entry sequences to three-letter amino acid sequences, separated by a specified separator. It is a case-sensitive procedure.
**Inputs**
To start using the rename_three_letter_name procedure, enter one or more protein sequences for which you want to get three-letter sequences. After the protein sequences put a symbol (type 'str') that will be a separator. And specify the `options = ‘3Letter_name’`.
**Outputs**
The result of the procedure is a list of three-letter sequences. Each amino acid is separated by the specified separator. The case of the three-letter amino acid coincides with the case of the one-letter designation at the input.
**Usage example**
```python
protein_tool('wWGPdPA', '', options = '3Letter_name') # ['trpTRPGLYPROaspPROALA']
protein_tool('LAlLAlwWGPdPA', '-', options = '3Letter_name') # ['LEU-ALA-leu-LEU-ALA-leu-trp-TRP-GLY-PRO-asp-PRO-ALA']
protein_tool('RRRrrrR', 'WGPdPA', 'LAlLAlw', options = 'percentage') # [{'R': 57.14, 'r': 42.86}, {'P': 33.33, 'W': 16.67, 'G': 16.67, 'd': 16.67, 'A': 16.67}, {'L': 28.57, 'A': 28.57, 'l': 28.57, 'w': 14.29}]
protein_tool('qwerty', 'G', options = '3Letter_name') # ['glnGtrpGgluGargGthrGtyr']
```

***DNA_code***
**Introduction**
The **DNA_code** procedure transforms a protein into a DNA sequence that may encode it (this can be used in genetic ingeneering).
P.S. codons chosen at the discretion of the tool authors.
**Inputs**
To start using the DNA_code procedure, enter one or more protein sequences for which you want to get a summary, and at the end add `options = ‘DNA_code’`.
**Outputs**
The result of the procedure is a list with type 'str' elements - nucleotide sequence that corresponds to the amino acid sequence.
**Usage example**
```python
protein_tool('LAlLAlwWGPdPA', options = 'DNA_code') # ['TTAGCAttaTTAGCAttatggTGGGGGCCCgcaCCCGCA']
protein_tool('RRRrrrR', 'WGPdPA', 'LAlLAlw', options = 'DNA_code') # ['CGACGACGAcgacgacgaCGA', 'TGGGGGCCCgcaCCCGCA', 'TTAGCAttaTTAGCAttatgg']
```

## fastq_tools.py
> *description of how the run_dna_rna_tools.py program works*

This program contains the function `fastq_tool`. The `fastq_tools` function takes as input a dictionary of the fastaq data and sort it by the length, quality of sequencing of each nucleotides and GC% content.
The result of the running of the tool is sorted dictionary of the dictionary from the input.
'gc_bounds' - GC composition interval (in percentage) for filtering (by default results (0, 100), i.e. all reads in the direction). If you pass one number as an argument, it is considered to be the upper limit. Examples: gc_bounds = (20, 80) - save only reads with GC content from 20 to 80%, gc_bounds = 44.4 - save reads with GC content less than 44.4%.
'length_bounds' - length of the interval for filtering, still gc_bounds, but by default it is (0, 2**32).
'quality_threshold' - threshold value of average read quality for the filter, default is 0 (phred33 scale). Reads contribute to quality for all nucleotides below the threshold are discarded.

**Use example**
```python
seqs = {
# 'name' : ('sequence', 'quality')
'@SRX079804:1:SRR292678:1:1101:21885:21885': ('ACAGCAACATAAACATGATGGGATGGCGTAAGCCCCCGAGATATCAGTTTACCCAGGATAAGAGATTAAATTATGAGCAACATTATTAA', 'FGGGFGGGFGGGFGDFGCEBB@CCDFDDFFFFBFFGFGEFDFFFF;D@DD>C@DDGGGDFGDGG?GFGFEGFGGEF@FDGGGFGFBGGD'),
'@SRX079804:1:SRR292678:1:1101:24563:24563': ('ATTAGCGAGGAGGAGTGCTGAGAAGATGTCGCCTACGCCGTTGAAATTCCCTTCAATCAGGGGGTACTGGAGGATACGAGTTTGTGTG', 'BFFFFFFFB@B@A<@D>BDDACDDDEBEDEFFFBFFFEFFDFFF=CC@DDFD8FFFFFFF8/+.2,@7<<:?B/:<><-><@.A*C>D'),
'@SRX079804:1:SRR292678:1:1101:30161:30161': ('GAACGACAGCAGCTCCTGCATAACCGCGTCCTTCTTCTTTAGCGTTGTGCAAAGCATGTTTTGTATTACGGGCATCTCGAGCGAATC', 'DFFFEGDGGGGFGGEDCCDCEFFFFCCCCCB>CEBFGFBGGG?DE=:6@=>A<A>D?D8DCEE:>EEABE5D@5:DDCA;EEE-DCD'),
'@SRX079804:1:SRR292678:1:1101:171075:171075': ('CATTATAGTAATACGGAAGATGACTTGCTGTTATCATTACAGCTCCATCGCATGAATAATTCTCTAATATAGTTGTCAT', 'HGHHHHGFHHHHFHHEHHHHFGEHFGFGGGHHEEGHHEEHBHHFGDDECEGGGEFGF<FGGIIGEBGDFFFGFFGGFGF'),
'@SRX079804:1:SRR292678:1:1101:175500:175500': ('GACGCCGTGGCTGCACTATTTGAGGCACCTGTCCTCGAAGGGAAGTTCATCTCGACGCGTGTCACTATGACATGAATG', 'GGGGGFFCFEEEFFDGFBGGGA5DG@5DDCBDDE=GFADDFF5BE49<<<BDD?CE<A<8:59;@C.C9CECBAC=DE'),

}

fasta_filtering(seqs) # {'@SRX079804:1:SRR292678:1:1101:21885:21885': ('ACAGCAACATAAACATGATGGGATGGCGTAAGCCCCCGAGATATCAGTTTACCCAGGATAAGAGATTAAATTATGAGCAACATTATTAA', 'FGGGFGGGFGGGFGDFGCEBB@CCDFDDFFFFBFFGFGEFDFFFF;D@DD>C@DDGGGDFGDGG?GFGFEGFGGEF@FDGGGFGFBGGD'), '@SRX079804:1:SRR292678:1:1101:171075:171075': ('CATTATAGTAATACGGAAGATGACTTGCTGTTATCATTACAGCTCCATCGCATGAATAATTCTCTAATATAGTTGTCAT', 'HGHHHHGFHHHHFHHEHHHHFGEHFGFGGGHHEEGHHEEHBHHFGDDECEGGGEFGF<FGGIIGEBGDFFFGFFGGFGF')}



Binary file added RandomForest_before.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
112 changes: 112 additions & 0 deletions Showcases.ipynb
Original file line number Diff line number Diff line change
@@ -0,0 +1,112 @@
{
"cells": [
{
"cell_type": "markdown",
"id": "00fd4357-3461-449d-99f3-cd84258d43bb",
"metadata": {},
"source": [
"# RandomForestClassifierCustom с многопоточгостью "
]
},
{
"cell_type": "code",
"execution_count": 3,
"id": "53d6c283-a41f-4e0a-9f1b-6ff1f9d26d9b",
"metadata": {},
"outputs": [],
"source": [
"from sklearn.datasets import make_classification\n",
"from custom_random_forest import RandomForestClassifierCustom\n",
"import numpy as np\n",
"import time"
]
},
{
"cell_type": "code",
"execution_count": 4,
"id": "cce40041-bd48-49e3-9f15-c3c4cac2d3ee",
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Время выполнения fit с 1 потоком: 6.72442626953125\n",
"Время выполнения fit с 2 потоками: 6.9135894775390625\n",
"Время выполнения predict с 1 потоком: 0.16434144973754883\n",
"Время выполнения predict с 2 потоками: 0.16273832321166992\n",
"Полученные предсказания совпадают: True\n"
]
}
],
"source": [
"X, y = make_classification(n_samples=100000)\n",
"random_forest = RandomForestClassifierCustom(max_depth=30, n_estimators=10, \n",
" max_features=2, random_state=42)\n",
"\n",
"# 1 поток предсказание\n",
"start_time = time.time()\n",
"random_forest.fit(X, y)\n",
"fit_time_1_job = time.time() - start_time\n",
"\n",
"# 2 потока предсказание\n",
"start_time = time.time()\n",
"y_pred_1_job = random_forest.predict(X)\n",
"predict_time_1_job = time.time() - start_time\n",
"\n",
"# 1 поток\n",
"start_time = time.time()\n",
"random_forest.fit(X, y)\n",
"fit_time_2_jobs = time.time() - start_time\n",
"\n",
"# 2 потока\n",
"start_time = time.time()\n",
"y_pred_2_jobs = random_forest.predict(X)\n",
"predict_time_2_jobs = time.time() - start_time\n",
Comment on lines +43 to +65
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Что-то кажется тут всё у тебя в 1 процесс выполняется:)
Ну и тут у тебя по идее должны быть не потоки, а процессы.

При этом не обязательно что с 2 процессами будет прям четко в два раза меньше, это окей, но тут уже точно никак разницы быть не может, ты же не пересоздаешь RandomForest

"\n",
"print(\"Время выполнения fit с 1 потоком:\", fit_time_1_job)\n",
"print(\"Время выполнения fit с 2 потоками:\", fit_time_2_jobs)\n",
"print(\"Время выполнения predict с 1 потоком:\", predict_time_1_job)\n",
"print(\"Время выполнения predict с 2 потоками:\", predict_time_2_jobs)\n",
"print(\"Полученные предсказания совпадают:\", np.array_equal(y_pred_1_job, y_pred_2_jobs))\n"
]
},
{
"cell_type": "markdown",
"id": "84bcae36-3129-4a95-9835-e18b8b0f365e",
"metadata": {},
"source": [
"Вообще оно работало чуть лучше, почему стало хуже я не понимаю, как и не понимал на всем курсе по ML почему иногда тот или иной код работает значительно хуже "
]
},
{
"cell_type": "markdown",
"id": "4dedad29-d2b8-40ea-a77f-78a5226b338b",
"metadata": {},
"source": [
"![Вообще оно работало чуть лучше, почему стало хуже я не понимаю, как и не понимал на всем курсе по ML почему иногда тот или иной код работает значительно хуже ](RandomForest_before.png)"
]
}
],
"metadata": {
"kernelspec": {
"display_name": "Python 3 (ipykernel)",
"language": "python",
"name": "python3"
},
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.12.0"
}
},
"nbformat": 4,
"nbformat_minor": 5
}
66 changes: 66 additions & 0 deletions bio_files_processor.py
Original file line number Diff line number Diff line change
@@ -1,5 +1,9 @@
from os import makedirs
import os.path
import time
import os
import shutil
import tempfile
Comment on lines 1 to +6
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Порядок импортов не очень верный:)

Ну и не надо импортировать os.path, обычно импортируют os и в нем обращаются к path



def convert_multiline_fasta_to_oneline(path_input: str, output_fasta = None):
Expand Down Expand Up @@ -37,3 +41,65 @@ def convert_multiline_fasta_to_oneline(path_input: str, output_fasta = None):
with open(output_fasta, mode='w') as f:
for line in list_for_printing:
f.write(line + '\n')



Comment on lines +44 to +46
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Отступ 2 строки

class FastaRecord:
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Классы принято определять до функций

def __init__(self, fasta_id, description, sequence):
self.id = fasta_id
self.description = description
self.sequence = sequence
Comment on lines +48 to +51
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Тут была бы очень полезна аннотация типов:)


def __repr__(self):
return f"FastaRecord(id={self.id}, description={self.description}, sequence={self.sequence})"

class OpenFasta:
def __init__(self, file_path, mode='r'):
self.file_path = file_path
self.mode = mode

def __enter__(self):
self.file = open(self.file_path, self.mode)
return self

def __exit__(self, exc_type, exc_value, traceback):
if self.file:
self.file.close()

def __iter__(self):
return self

def __next__(self):
header = None
lines = []

while True:
line = self.file.readline()
if not line:
if header is not None:
return FastaRecord(fasta_id=header[0], description=header[1], sequence=''.join(lines))
else:
raise StopIteration

line = line.strip()

if line.startswith('>'):
if header is not None:
return FastaRecord(fasta_id=header[0], description=header[1], sequence=''.join(lines))
else:
header = self.parse_header(line)
lines = []
else:
lines.append(line)

def parse_header(self, header_line):
parts = header_line[1:].split(maxsplit=1)
fasta_id = parts[0]
description = parts[1] if len(parts) > 1 else ''
return fasta_id, description

def read_record(self):
return next(self)

def read_records(self):
return list(self)
Loading