Skip to content

RachelSilverstein/HT-PAMDA-2

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

33 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Kleinstiver Lab

High-Throughput PAM Determination Assay 2 (HT-PAMDA-2)

Overview

Updated version of HT-PAMDA software. HT-PAMDA is used to comprehensively profile the protospacer-adjacent motif (PAM) preferences of CRISPR-Cas nucleases. This repository contains code to perform analysis of data that has been generated using the HT-PAMDA method as described in Walton et al. (Science, 2020).

New in version 2

HT-PAMDA-2 analysis software has better compatibility with 'relaxed' PAM variants such as SpRY:

  1. Correction of "uptrends" in read counts of uncleaved PAMs at later timepoints.
  2. Option to normalize reads to control substrates added to PAM library (uncleavable spacers) instead of least cleaved PAMs.
SpCas9 - Version 1 SpRY - Version 1
SpCas9 - Version 2 SpRY - Version 2

Installation

Requires Python 3.11.5

Download the repository (on Github use the green "Clone or download" button and select "Download Zip"). Expand the zip file in a convenient location.

In Terminal, go to the repository directory and create a Python 3 virtual environment. We suggest using python 3.8.2 or installation of requirements in install.sh may cause errors.

python3 -m venv venv

This will create a virtual environment called venv. Activate the virtual environment:

source venv/bin/activate

Next, the commands in install.sh will add the required packages to the venv virtual environment. The installation should take no more than a few minutes.

sh install.sh

The required dependencies are now installed to the virtual environment.

Perform all steps of the analysis within this virtual environment.

Folder structure

The repository has the following folder structure:

  • barcode_csv: directory containing example BARCODE_CSV files indicating sample barcoding
  • code: directory containing the HT-PAMDA scripts
  • fastqs: directory containing example fastq files
  • figures: directory where figures generated from the analysis are saved
  • output: directory where the HT-PAMDA output files are saved

Analysis

There are two main sections of the analysis:

  1. Randomized PAM library quality control: Assess the distribution of PAM sequences in an untreated randomized library control. This step is optional; if the uncleaved library is pooled together with a timepoint library then you can proceed to step 2.
  2. HT-PAMDA data analysis: Analyze HT-PAMDA data to define PAM preferences of CRISPR-Cas nucleases.

Example data has been provided to run both sections of the analysis.

Randomized PAM library quality control

The following function performs the complete randomized PAM library quality control analysis:

library_QC: Takes fastq files as input and determines the distribution of PAMs in the randomized PAM library. Raw read counts are saved to the output folder. Figures describing the library distribution are saved to the figures folder.

To run the library QC analysis:

Navigate to the code directory, open the library_QC_inputs.py file, and enter the required parameters. Run the analysis:

python3 library_QC.py

On the provided example data, this step should only take a few seconds.

Input parameters

Required parameters

These parameters are likely to change with any given implementation of the assay. Please enter values for all the following parameters. Leave default values to run an example dataset.

RUN_NAME: Provide a name for the run (no spaces or special characters).

BARCODE_CSV: Filepath to a CSV with the control barcode information and the following headers:

sample description P5_sample_barcode P7_sample_barcode
unique_sample_id_01 control ATGC TCGC

Barcodes should be provided 5' to 3' as they appear in the primer sequences that encode them. Avoid the use of special characters.

FASTQ_DIR: Folder directory contianing fastq files.

CONTROL_FASTQ: Abbreviated name of the fastq files for the library. Fastq names must be abbreviated as follows:

fastq complete file names abbreviated name
control_S1_L001_R1_001.fastq.gz control_S1
control_S1_L001_R2_001.fastq.gz
control_S1_L002_R1_001.fastq.gz
control_S1_L002_R2_001.fastq.gz
control_S1_L003_R1_001.fastq.gz
control_S1_L003_R2_001.fastq.gz
control_S1_L004_R1_001.fastq.gz
control_S1_L004_R2_001.fastq.gz

PAM_ORIENTATION: Orientation of the PAM relative to the spacer (three_prime (Cas9) or five_prime (Cas12)).

PAM_LENGTH: Number of bases to include in the PAM.

PAM_START: Position relative to the spacer to begin defining the PAM. Enter 0 to start immediately adjacent to the spacer. Many CRISPR-Cas nucleases have extended PAM preferences that may make it advantageous to consider more distal positions as the "start" of the PAM. For example, for the canonical Staphylococcus aureus Cas9 PAM of "NNGRRT", it may be desirable to define PAM_START = 2, to consider a 4 nucleotide "GRRT" PAM, rather than the full 6 nucleotides.

Examples for specifying the PAM sequence:

Specifying the PAM_LENGTH and PAM_START arguments for an example spacer and three_prime PAM orientation:

5'-[SPACER][PAM]-3'    
5'-[SPACER]CGGTA-3'
           01234  (PAM_START)

Examples:

PAM_LENGTH PAM_START PAM sequence
3 0 CGG
4 0 CGGT
3 1 GGT

Specifying the PAM_LENGTH and PAM_START arguments for an example spacer and five_prime PAM orientation:

5'-[PAM][SPACER]-3'    
5'-CTTTA[SPACER]-3'
   43210 (PAM_START)

Examples:

PAM_LENGTH PAM_START PAM sequence
5 0 CTTTA
4 0 TTTA
4 1 CTTT

CONTROL_SAMPLE: Unique sample ID of the untreated randomized PAM library control sample.

Additional parameters

The following arguments have default values consistent with our standard HT-PAMDA implementation. They are defined here with the intention of providing flexibility for changes to assay design. These values do not need to be changed to run the analysis for our standard HT-PAMDA protocol. Changes to assay design will likely require changes to these parameters.

MAX_PAM_LENGTH: Integer. The maximum PAM length that will be considered, starting immediately adjacent to the spacer. PAMs of this length will be enumerated from fastq files. PAMs will later be truncated to the bases indicated by PAM_START and PAM_LENGTH. Default value is 8.

SPACERS: Dictionary with key = spacer name, value = spacer sequence. Default spacers: {'SPACER1':'GGGCACGGGCAGCTTGCCGG', 'SPACER2':'GTCGCCCTCGAACTTCACCT'}

CONTROL_SPACERS: NEW in verion 2. Dictionary with key = spacer name, value = spacer sequence or None. Designates spacers spiked into PAM library without a matching gRNA. Used as uncleavable control substrates to which read counts for each PAM will be normalized. Naming of control spacers should be distinct form SPACERS parameter. To not use control spacers, set this parameter to None, and reads will instead be normalized to the least cleaved PAMs within the library as in version 1. Default control spacers:

CONTROL_SPACERS = {'SPACER03': "GTCACCTCCAATGACTAGGG",
                   'SPACER04': "GAAATGAACTAGAAAGAAAT",
                   'SPACER05': "GAGACGTTCATGACTGGCAT",
                   'SPACER06': "GCTTTGCTACAACCCCAGCA",
                   'SPACER08': "GAAGCGGAGCGTCCCGCCAG",
                   'SPACER09': "GGGTGGTTCCATAATCTGTG",
                   'SPACER10': "GCTGGGTGAATGGAGCGAGC",
                   'SPACER11': "GCAGAAGGGATTCCATGAGG",
                   'SPACER12': "GCAGACGGCAGTCACTAGGG"}

P5_SAMPLE_BARCODE_START: Integer, location of the 5' end of the P5 sample barcode. Default = 2.

P7_SAMPLE_BARCODE_START: Integer, location of the 5' end of the P7 sample barcode. Default = 2.

Example P5 and P7 barcodes in an example amplicon for a 3' PAM library below. Barcodes are the capitalized "NNNN" sequences, read from 5' to 3' on their respective strands:

             P7 BARCODE                                                
POSITION:  012
        5' --NNNN-----------------[SPACER][PAM]-----------------nnnn-- 3'
        3' --nnnn-----------------[SPACER][PAM]-----------------NNNN-- 5'
                                                    POSITION:      210
                                                                P5 BARCODE

HT-PAMDA data analysis

The analysis consists of three steps plus figure generation to represent PAM preference as a heatmap.

The following function performs the complete analysis:

PAMDA_complete: Run the complete pipeline from fastq files to rate constants and heatmaps of each sample. Takes fastq files and CSV with sample barcodes as input. Outputs CSV files for raw counts, normalized counts, and rates. Also outputs heatmaps as PDF and CSV files.

function input outputs
PAMDA_complete fastq files PAMDA_1_raw_counts.csv.gz
PAMDA_2_norm_counts.csv
PAMDA_3_rates.csv
heatmaps

Or the following functions can be used to perform these steps separately:

  1. fastq2count: Convert fastq files to raw read counts for each sample, spacer, and PAM. Takes fastq files and CSV with sample barcodes as input. Outputs a compressed CSV file with raw read counts.
  2. rawcount2normcount: Calculate normalized read counts from raw read counts. Takes a compressed CSV with raw counts as input. Outputs CSV file with normalized read counts.
  3. normcount2rate: Calculate rate constants from normalized read counts. Takes CSV with normalized counts as input. Outputs CSV file with rate constants.
  4. rate2heatmap: Plot heat maps representing the PAM profiles of each sample. Takes CSV with rate constants as input. Outputs heatmaps as PDF and CSV files.
function input output
fastq2count fastq files PAMDA_1_raw_counts.csv.gz
rawcount2normcount PAMDA_1_raw_counts.csv.gz PAMDA_2_norm_counts.csv
normcount2rate PAMDA_2_norm_counts.csv PAMDA_3_rates.csv
rate2heatmap PAMDA_3_rates.csv heatmaps

To run the HT-PAMDA analysis:

Navigate to the code directory, open the inputs.py file, and enter the required parameters. Run the complete analysis:

python3 PAMDA_complete.py

Or run individual steps of the analysis:

python3 fastq2count.py
python3 rawcount2normcount.py
python3 normcount2rate.py
python3 rate2heatmap.py

The analysis can be run on the provided example data by leaving all parameters at their default values. On the example data, the complete analysis should take about a minute.

Additionally, barcodes for all samples from Walton et al. (Science, 2020) are available (Table S7 - PAMDA data summary) and can be used to analyze HT-PAMDA data uploaded to the NCBI sequence read archive (SRA) under BioProject ID: PRJNA605711.

Input parameters

Required parameters

These parameters are likely to change with any given implementation of the assay. Please enter values for all the following parameters. Leave default values to run an example dataset.

RUN_NAME: Provide a name for the run (no spaces or special characters).

BARCODE_CSV: Filepath to a CSV with the barcode information and the following headers:

sample description P5_sample_barcode P7_sample_barcode
unique_sample_id_01 WT_SpCas9 CCTG TGAC
unique_sample_id_02 SpG ATTC TACT
unique_sample_id_03 SpRY CTAC ACCG

Barcodes should be provided 5' to 3' as they appear in the primer sequences that encode them. Avoid the use of special characters.

FASTQ_DIR: Folder directory contianing all fastq files.

TIMEPOINT_FASTQ: A Python dictionary to indicate the timepoint of each set of fastq files. The fastq determines the timepoint (except for the untreated library control). Indexing of timepoints must start at zero (first timepoint = 0, second timepoint = 1, etc.). Timepoint fastq names must be abbreviated as demonstrated in the following example:

fastq complete file names key in TIMEPOINT_FASTQ dictionary timepoint value
timepoint1_S1_L001_R1_001.fastq.gz timepoint1_S1 0
timepoint1_S1_L001_R2_001.fastq.gz
timepoint1_S1_L002_R1_001.fastq.gz
timepoint1_S1_L002_R2_001.fastq.gz
timepoint1_S1_L003_R1_001.fastq.gz
timepoint1_S1_L003_R2_001.fastq.gz
timepoint1_S1_L004_R1_001.fastq.gz
timepoint1_S1_L004_R2_001.fastq.gz
timepoint2_S2_L001_R1_001.fastq.gz timepoint2_S2 1
timepoint2_S2_L001_R2_001.fastq.gz
timepoint2_S2_L002_R1_001.fastq.gz
timepoint2_S2_L002_R2_001.fastq.gz
timepoint2_S2_L003_R1_001.fastq.gz
timepoint2_S2_L003_R2_001.fastq.gz
timepoint2_S2_L004_R1_001.fastq.gz
timepoint2_S2_L004_R2_001.fastq.gz
timepoint3_S3_L001_R1_001.fastq.gz timepoint3_S3 2
timepoint3_S3_L001_R2_001.fastq.gz
timepoint3_S3_L002_R1_001.fastq.gz
timepoint3_S3_L002_R2_001.fastq.gz
timepoint3_S3_L003_R1_001.fastq.gz
timepoint3_S3_L003_R2_001.fastq.gz
timepoint3_S3_L004_R1_001.fastq.gz
timepoint3_S3_L004_R2_001.fastq.gz

Here, TIMEPOINT_FASTQ = { 'timepoint1_S1': 0, 'timepoint2_S2': 1, 'timepoint3_S3': 2 }

PAM_ORIENTATION: Orientation of the PAM relative to the spacer (three_prime (Cas9) or five_prime (Cas12)).

PAM_LENGTH: Number of bases to include in the PAM.

PAM_START: Position relative to the spacer to begin defining the PAM. Enter 0 to start immediately adjacent to the spacer. Many CRISPR-Cas nucleases have extended PAM preferences that may make it advantageous to consider more distal positions as the "start" of the PAM. For example, for the canonical Staphylococcus aureus Cas9 PAM of "NNGRRT", it may be desirable to define PAM_START = 2, to consider a 4 nucleotide "GRRT" PAM, rather than the full 6 nucleotides.

Examples for specifying the PAM sequence:

Specifying the PAM_LENGTH and PAM_START arguments for an example spacer and three_prime PAM orientation:

5'-[SPACER][PAM]-3'    
5'-[SPACER]CGGTA-3'
           01234  (PAM_START)

Examples:

PAM_LENGTH PAM_START PAM sequence
3 0 CGG
4 0 CGGT
3 1 GGT

Specifying the PAM_LENGTH and PAM_START arguments for an example spacer and five_prime PAM orientation:

5'-[PAM][SPACER]-3'    
5'-CTTTA[SPACER]-3'
   43210 (PAM_START)

Examples:

PAM_LENGTH PAM_START PAM sequence
5 0 CTTTA
4 0 TTTA
4 1 CTTT

CONTROL_RAW_COUNT_CSV: Filepath to the "PAMDA_1_raw_counts_csv.gz" output from the randomized PAM library quality control analysis. If the quality control analysis was not performed and the untreated PAM library control sample is instead pooled with unique sample barcodes in one of the timepoint fastqs, set CONTROL_RAW_COUNT_CSV = None and instead indicate the timepoint fastq containing the control sample in the CONTROL_SAMPLE_TIMEPOINT_FASTQ parameter.

CONTROL_SAMPLE: Unique sample ID of the untreated randomized PAM library control sample.

Additional parameters

The following arguments have default values consistent with our standard HT-PAMDA implementation. They are defined here with the intention of providing flexibility for changes to assay design, analysis parameters, and figure generation. These values do not need to be changed to run the analysis for our standard HT-PAMDA protocol. Changes to assay design will likely require changes to these parameters.

CONTROL_SAMPLE_TIMEPOINT_FASTQ: Integer index of the timepoint fastq that contains the control sample. If the quality control analysis was not performed and the untreated PAM library control sample is instead pooled with unique sample barcodes in one of the timepoint fastqs, set CONTROL_RAW_COUNT_CSV = None and instead indicate the timepoint fastq containing the control sample in the CONTROL_SAMPLE_TIMEPOINT_FASTQ parameter. If the control were pooled in the timepoint 3 fastq, then the value of CONTROL_SAMPLE_TIMEPOINT_FASTQ would be 3.

TIMEPOINTS: List of integer timepoints used, including the zeroth timepoint. Use a consistent unit. Default is [0, 60, 480, 1920] (seconds).

MAX_PAM_LENGTH: Integer. The maximum PAM length that will be considered, starting immediately adjacent to the spacer. PAMs of this length will be enumerated from fastq files. PAMs will later be truncated to the bases indicated by PAM_START and PAM_LENGTH. Default value is 8.

The following parameters should be changed if target site design, amplicon design, or library preparation were altered from those used in Walton et al. (Science, 2020).

SPACERS: Dictionary with key = spacer name, value = spacer sequence. Default spacers: {'SPACER1':'GGGCACGGGCAGCTTGCCGG', 'SPACER2':'GTCGCCCTCGAACTTCACCT'}

CONTROL_SPACERS: NEW in verion 2. Dictionary with key = spacer name, value = spacer sequence or None. Designates spacers spiked into PAM library without a matching gRNA. Used as uncleavable control substrates to which read counts for each PAM will be normalized. Naming of control spacers should be distinct form SPACERS parameter. To not use control spacers, set this parameter to None, and reads will instead be normalized to the least cleaved PAMs within the library as in version 1. Default control spacers:

CONTROL_SPACERS = {'SPACER03': "GTCACCTCCAATGACTAGGG",
                   'SPACER04': "GAAATGAACTAGAAAGAAAT",
                   'SPACER05': "GAGACGTTCATGACTGGCAT",
                   'SPACER06': "GCTTTGCTACAACCCCAGCA",
                   'SPACER08': "GAAGCGGAGCGTCCCGCCAG",
                   'SPACER09': "GGGTGGTTCCATAATCTGTG",
                   'SPACER10': "GCTGGGTGAATGGAGCGAGC",
                   'SPACER11': "GCAGAAGGGATTCCATGAGG",
                   'SPACER12': "GCAGACGGCAGTCACTAGGG"}

CONTROL_SPACER_MAPPING: NEW in version 2. Dictionary with key = spacer name, value = list of control spacer names. Designates which control spacers are spiked into which library. Spacers spiked into different libraries must be distinct for demultiplexing purposes. If control spacers were not use, set this parameter to None. Default control spacer mapping:

CONTROL_SPACER_MAPPING = {'SPACER01': ["SPACER03", "SPACER04", "SPACER05", "SPACER06"],
                          'SPACER02': ["SPACER08", "SPACER09", "SPACER10", "SPACER11", "SPACER12"]}

P5_SAMPLE_BARCODE_START: Integer, location of the 5' end of the P5 sample barcode. Default = 2.

P7_SAMPLE_BARCODE_START: Integer, location of the 5' end of the P7 sample barcode. Default = 2.

Example P5 and P7 barcodes in an example amplicon for a 3' PAM library below. Barcodes are the capitalized "NNNN" sequences, read from 5' to 3' on their respective strands:

             P7 BARCODE                                                
POSITION:  012
        5' --NNNN-----------------[SPACER][PAM]-----------------nnnn-- 3'
        3' --nnnn-----------------[SPACER][PAM]-----------------NNNN-- 5'
                                                    POSITION:      210
                                                                P5 BARCODE

Addional arguments for normalization, rate constant calculation, and heat map generation:

USE_TIMEPOINTS: Default (None) will use all timepoints to fit rate constants. To use only a subset, provide a list specifing by the indices of the TIMEPOINTS list to use. For example, to use only timepoints 0 and 3, enter: [0,3]

TOP_N_NORMALIZE: For each sample, PAM enrichment is normalized to reflect no depletion. Default is to average the top 5 most enriched PAMs to define a per-timepoint normalization. To change, provide the desired integer value.

INIT_RATE_EST: Nonlinear rate calculations require initial rate estimates. Default is [0.0001, 0.001, 0.01]. To change, provide a list of floats.

READ_SUM_MIN: Minimum number of total raw reads for a PAM across all timepoints to calculate a rate. Otherwise rate value will be NaN. Default is 4.

TPS_SUM_MIN: Minimum number of timepoints with non-zero raw read count for a PAM to calculate a rate. Otherwise rate value will be NaN. Default is 1.

The following options are for formatting heatmaps. The heatmap representation of PAM preference splits the bases of the PAM across the y- and x-axis. For example, an ACGT PAM could be represented with AC on the y-axis and GT on the x-axis. The following options are intended to allow customization of this representation. Rate constants of PAM targeting are used to color the heatmap where darker blue indcates faster PAM targeting.

PAM1_NT_RANK: Dictionary describing the ordering of nucleotides on the heatmap y-axis. An example change might group purines (A and G) and pyrimidines (C and T) together: {1:'A',2:'G',3:'C',4:'T'}. Default is {1:'A',2:'C',3:'G',4:'T'}

PAM2_NT_RANK: Dictionary describing the ordering of nucleotides on the heatmap x-axis. An example change might group purines (A and G) and pyrimidines (C and T) together: {1:'A',2:'G',3:'C',4:'T'}. Default is {1:'A',2:'C',3:'G',4:'T'}

PAM1_INDEX_RANK and PAM2_INDEX_RANK determine how the heatmap axes are defined and how positions of the PAM are ordered. The bases of the PAM will be split across the axes. Both are lists of integers. The length of each list will determine the number of bases that are represented on each axis. The position of the list corresponds to the position in the first or second half of the PAM and the integer value at each position in the list corresponds to the priority of the position. A higher integer value indicates a higher priority.

PAM1_INDEX_RANK: Ranking of nucleotide positions on the heatmap y-axis (first half of the PAM), represented as a list of integers (determines order of rows). Default None will use a default organization. To change, provide a list of integers like [2,1] where the first position is given a priority of 2 and the second position is given a priority of 1. If specified, the length of PAM1_INDEX_RANK and PAM2_INDEX_RANK must add to the total PAM_LENGTH.

PAM2_INDEX_RANK: Ranking of nucleotide positions on the heatmap x-axis (second half of the PAM), represented as a list of integers (determines order of columns). Default None will use a default organization. To change, provide a list of integers like [2,1] where the first position is given a priority of 2 and the second position is given a priority of 1. If specified, the length of PAM1_INDEX_RANK and PAM2_INDEX_RANK must add to the total PAM_LENGTH.

AVERAGE_SPACER: Average rates across spacers for the heatmap. Default is True. If False, separate heatmaps are generated for each spacer.

HEATMAP_FIXED_MIN: Minimum value of heatmap. Default is -1.5 (log scale). Set to False to automatically choose the minimum value for each sample from rate values.

HEATMAP_FIXED_MAX: Maximum value of heatmap. Default is -4.3 (log scale). Set to False to automatically choose the maximum value for each sample from rate values.

LOG_SCALE_HEATMAP: Plot log10(rates) or rates. True or False. Default True plots log10(rates).

About

Analysis pipeline for CRISPR high-throughput PAM determination assay (HT-PAMDA) data

Resources

Stars

Watchers

Forks

Releases

Packages

Contributors

Languages