A Shiny app for generating sample sheets for use in Illumina sequencing.
This app is a replacement/supplement to the Illumina Experiment Manager. Its main purpose is to generate sample sheets for use with bcl2fastq. Several indexing kits are already included (see "supported kits" button), for new kits please open an issue. Note that only indexing kits with pre-defined index well positions are supported.
The app is deployed on Digital Ocean HERE, and is always up-to-date thanks to GitHub Actions! For local usage just clone the repository and start app.R in RStudio.
The app first reads the user input (data pasted in the input text field) and then simply joins (inner join) the user data with the index data by well position and index set. The index data for all supported kits is present in indexdata/indexcsv.csv and can easily be extended with other kits. Fast reading of the index data is achieved with fread() from data.table. After that, various other inputs are collected to construct the final sample sheet according to the Illumina specifications.
- The forward strand workflow is performed on the NovaSeq 6000, MiSeq, HiSeq 2000/2500, NextSeq 2000.
- The reverse complement workflow is performed on the iSeq, MiniSeq, NextSeq 500, HiSeq 3000/4000/X.
In this repository, and in the indexcsv.csv file, miseq means forward strand workflow and nextseq means reverse strand workflow.
- TruSeq single index- and TruSeq CD index-based kits:
Adapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead2, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT- AmpliSeq for Illumina;
- Illumina DNA Prep (M) Tagmentation (previously Nextera DNA Flex);
- Illumina DNA Prep with Enrichment (S) Tagmentation (previously Nextera Flex for Enrichment);
- Nextera DNA;
- Nextera XT;
- Nextera Enrichment;
- Nextera Rapid Capture Enrichment;
- TruSight Enrichment;
- TruSight Rapid Capture Enrichment;
- TruSight HLA;
- Illumina Stranded mRNA Prep, Ligation;
- Illumina Stranded Total RNA Prep, Ligation with Ribo-Zero Plus;
- Illumina RNA Prep with Enrichment, Ligation
Adapter, CTGTCTCTTATACACATCT- Illumina DNA PCR-Free Prep, Tagmentation
Adapter, CTGTCTCTTATACACATCT+ATGTGTATAAGAGACATrimming T-overhang options for the
- Illumina Stranded mRNA and
- Illumina Stranded Total RNA workflows
Add the following settings to the [Settings] section of the SampleSheet.csv file. These settings configure the FASTQ generation to start from the second cycle, skipping the T overhang.
[Settings]
Read1StartFromCycle,2
Read2StartFromCycle,2