fix: ONT amplicon pipeline uses dedicated ont_amplicon_params config (#79)

config.json

@@ -530,6 +530,12 @@
     "min_rq": 0.99,
     "threads": 8
   },
+  "ont_amplicon_params": {
+    "model_type": "errhmm",
+    "model_file": "reference/pbsim3/ERRHMM-ONT.model",
+    "threads": 8,
+    "accuracy_mean": 0.95
+  },
   "amplicon_params": {
     "forward_primer": "GGAGAAAAGGAGACTTCGGCTACCCAG",
     "reverse_primer": "GCCGTTGTGCACCAGAGTAGAAGCTGA",

docs/about/changelog.md

@@ -9,6 +9,17 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 
 ## [Unreleased]
 
+### Fixed
+- ONT amplicon pipeline now reads from dedicated `ont_amplicon_params` config section instead of `pacbio_params` -- was using PacBio Sequel model (ERRHMM-SEQUEL) for ONT reads (#79)
+- CLI routes `--model-file` overrides to `ont_amplicon_params` for ONT and `pacbio_params` for PacBio
+
+### Added
+- `ont_amplicon_params` config section with ONT-specific defaults (ERRHMM-ONT.model)
+- `OntAmpliconConfig` TypedDict for type-safe ONT parameter access
+- Config schema validation and path resolution for `ont_amplicon_params`
+- Test for ONT platform using `ont_amplicon_params` (not `pacbio_params`)
+- Documentation: ONT configuration section in amplicon simulation guide
+
 ---
 
 ## [0.43.4] - 2026-04-06

docs/guides/amplicon-simulation.md

@@ -108,16 +108,45 @@ Stages 1-4 (extraction, PCR bias, template generation) are shared. The platforms
 
 | Stage | PacBio (`--platform pacbio`) | ONT (`--platform ont`) |
 |-------|------------------------------|------------------------|
+| Config section | `pacbio_params` | `ont_amplicon_params` |
 | pbsim3 pass_num | 3+ (multi-pass CLR) | 1 (single-pass) |
 | Consensus | CCS (multi-pass -> HiFi) | None (skip) |
 | minimap2 preset | `map-hifi` | `map-ont` |
-| Error model | `QSHMM-SEQUEL.model` etc. | `ERRHMM-ONT-HQ.model` etc. |
+| Error model | `QSHMM-SEQUEL.model` etc. | `ERRHMM-ONT.model` etc. |
 | Output suffix | `*_amplicon_hifi.bam` | `*_amplicon_ont.bam` |
 | Tool dependencies | pbsim3, ccs, samtools, minimap2 | pbsim3, samtools, minimap2 |
 
 !!! note "ONT does not require CCS"
     The ONT pipeline skips CCS consensus entirely. Each pbsim3 template produces one single-pass read, which is converted directly to FASTQ and aligned. This means `--coverage` maps directly to the number of output reads (before alignment filtering).
 
+### ONT Configuration
+
+The ONT amplicon pipeline reads from the `ont_amplicon_params` config section (separate from `pacbio_params`):
+
+```json
+"ont_amplicon_params": {
+    "model_type": "errhmm",
+    "model_file": "reference/pbsim3/ERRHMM-ONT.model",
+    "threads": 8,
+    "accuracy_mean": 0.95
+}
+```
+
+| Parameter | Type | Default | Description |
+|-----------|------|---------|-------------|
+| `model_type` | string | `"errhmm"` | pbsim3 model type (`errhmm` or `qshmm`) |
+| `model_file` | string | `ERRHMM-ONT.model` | pbsim3 ONT error model file |
+| `threads` | int | `8` | Number of threads |
+| `accuracy_mean` | float | `0.95` | Mean read accuracy |
+
+Available ONT models in `reference/pbsim3/`:
+
+- `ERRHMM-ONT.model` -- standard ONT error profile
+- `QSHMM-ONT.model` -- quality score ONT model
+- `QSHMM-ONT-HQ.model` -- high-quality ONT model (e.g., Kit14/Dorado)
+
+The `--model-file` CLI flag overrides `ont_amplicon_params.model_file` for ONT, and `pacbio_params.model_file` for PacBio.
+
 ---
 
 ## PCR Length Bias Model

docs/reference/configuration.md

@@ -33,6 +33,7 @@ MucOneUp requires a JSON configuration file specifying:
   "read_simulation": { ... },
   "nanosim_params": { ... },
   "pacbio_params": { ... },
+  "ont_amplicon_params": { ... },
   "amplicon_params": { ... }
 }
 ```
@@ -595,11 +596,44 @@ Parameters for PacBio HiFi read simulation.
 
 ---
 
+## ONT Amplicon Parameters Section
+
+### Purpose
+
+Parameters for ONT amplicon read simulation (pbsim3 single-pass mode). Separate from `pacbio_params` so each platform uses its own error model.
+
+### Structure
+
+```json
+{
+  "ont_amplicon_params": {
+    "model_type": "errhmm",
+    "model_file": "reference/pbsim3/ERRHMM-ONT.model",
+    "threads": 8,
+    "accuracy_mean": 0.95
+  }
+}
+```
+
+### Fields
+
+| Field | Type | Description | Default |
+|-------|------|-------------|---------|
+| `model_type` | string | "qshmm" or "errhmm" | "errhmm" |
+| `model_file` | string | pbsim3 ONT error model file | ERRHMM-ONT.model |
+| `threads` | number | Parallel threads (minimum 1) | 8 |
+| `seed` | integer | Random seed (null = random) | null |
+| `accuracy_mean` | number | Mean read accuracy (0.0-1.0) | 0.95 |
+
+Available ONT models: `ERRHMM-ONT.model`, `QSHMM-ONT.model`, `QSHMM-ONT-HQ.model`.
+
+---
+
 ## Amplicon Parameters Section
 
 ### Purpose
 
-Parameters for PacBio amplicon read simulation with PCR length bias modeling.
+Parameters for amplicon read simulation (shared by PacBio and ONT) with PCR length bias modeling.
 
 ### Structure
 
@@ -747,6 +781,13 @@ See the [Amplicon Simulation Guide](../guides/amplicon-simulation.md) for detail
     "min_rq": 0.99,
     "threads": 4,
     "seed": 42
+  },
+
+  "ont_amplicon_params": {
+    "model_type": "errhmm",
+    "model_file": "/path/to/pbsim3/ERRHMM-ONT.model",
+    "threads": 8,
+    "accuracy_mean": 0.95
   }
 }
 ```

muc_one_up/cli/commands/reads.py

@@ -136,6 +136,39 @@ def _setup_read_config(
         logging.info(f"Using random seed: {seed} (results will be reproducible)")
 
 
+def _apply_ont_amplicon_params(
+    config: dict[str, Any],
+    model_type: str | None,
+    model_file: str | None,
+    seed: int | None,
+) -> None:
+    """Apply ONT amplicon CLI overrides to ont_amplicon_params.
+
+    Mutates config in place. Uses ont_amplicon_params section (separate
+    from pacbio_params) so the ONT pipeline gets an ONT-specific model.
+    Falls back to sensible defaults (ERRHMM-ONT.model) when values are
+    missing or explicitly null.
+    """
+    if "ont_amplicon_params" not in config:
+        config["ont_amplicon_params"] = {}
+
+    params = config["ont_amplicon_params"]
+    if model_type is not None:
+        params["model_type"] = model_type
+    if model_file is not None:
+        params["model_file"] = model_file
+    if seed is not None:
+        params["seed"] = seed
+        logging.info("Using random seed: %d (results will be reproducible)", seed)
+
+    # Default to ERRHMM-ONT.model if missing or explicitly null
+    if not params.get("model_file"):
+        params["model_file"] = "reference/pbsim3/ERRHMM-ONT.model"
+        logging.info("Using default ONT model: %s", params["model_file"])
+    if not params.get("model_type"):
+        params["model_type"] = "errhmm"
+
+
 def _apply_pacbio_params(
     config: dict[str, Any],
     model_type: str | None,
@@ -564,7 +597,10 @@ def amplicon(
             "Add forward_primer and reverse_primer to config.json."
         )
 
-    _apply_pacbio_params(config, model_type, model_file, seed)
+    if platform == "ont":
+        _apply_ont_amplicon_params(config, model_type, model_file, seed)
+    else:
+        _apply_pacbio_params(config, model_type, model_file, seed)
 
     # Apply PCR bias overrides
     if "pcr_bias" not in config["amplicon_params"]:

muc_one_up/config.py

@@ -184,6 +184,21 @@
             ],
             "additionalProperties": False,
         },
+        "ont_amplicon_params": {
+            "type": "object",
+            "properties": {
+                "model_type": {"type": "string", "enum": ["qshmm", "errhmm"]},
+                "model_file": {"type": "string"},
+                "threads": {"type": "number", "minimum": 1},
+                "seed": {"type": ["number", "null"]},
+                "accuracy_mean": {
+                    "type": "number",
+                    "minimum": 0.0,
+                    "maximum": 1.0,
+                },
+            },
+            "additionalProperties": False,
+        },
         "constants": {
             "type": "object",
             # Allow either flat format (for backward compatibility with tests)
@@ -649,6 +664,7 @@ def load_config_raw(config_path: str) -> dict[str, Any]:
         "sample_target_bed",
     ],
     "pacbio_params": ["model_file"],
+    "ont_amplicon_params": ["model_file"],
 }
 
 

muc_one_up/read_simulator/ont_amplicon_pipeline.py

@@ -50,7 +50,7 @@ def simulate_ont_amplicon_pipeline(
     no CCS consensus). See module docstring for pipeline stages.
 
     Args:
-        config: Pipeline config with tools, amplicon_params, pacbio_params,
+        config: Pipeline config with tools, amplicon_params, ont_amplicon_params,
             read_simulation sections.
         input_fa: Input FASTA (haploid or diploid).
         human_reference: Optional reference for alignment.
@@ -68,10 +68,10 @@ def simulate_ont_amplicon_pipeline(
 
     from typing import cast
 
-    from ..type_defs import AmpliconConfig, PacbioConfig, ReadSimulationConfig
+    from ..type_defs import AmpliconConfig, OntAmpliconConfig, ReadSimulationConfig
 
     amplicon_params = cast(AmpliconConfig, config.get("amplicon_params", {}))
-    pacbio_params = cast(PacbioConfig, config.get("pacbio_params", {}))
+    ont_params = cast(OntAmpliconConfig, config.get("ont_amplicon_params", {}))
     tools = config.get("tools", {})
     rs_raw = config.get("read_simulation", {})
     rs_config = cast(ReadSimulationConfig, rs_raw)
@@ -81,20 +81,21 @@ def simulate_ont_amplicon_pipeline(
     samtools_cmd = tools.get("samtools", "samtools")
     minimap2_cmd = tools.get("minimap2", "minimap2")
 
-    # Params from config
-    model_type = pacbio_params["model_type"]
-    model_file = pacbio_params["model_file"]
-    threads = pacbio_params.get("threads", 4)
-    seed = pacbio_params.get("seed")
-    accuracy_mean = pacbio_params.get("accuracy_mean", 0.95)
+    # ONT-specific params — uses ont_amplicon_params (NOT pacbio_params)
+    # Treat None as missing (possible from partial configs with explicit nulls)
+    model_type = ont_params.get("model_type") or "errhmm"
+    model_file = ont_params.get("model_file") or "reference/pbsim3/ERRHMM-ONT.model"
+    threads = ont_params.get("threads") or 8
+    seed = ont_params.get("seed")  # None is valid here (random seed)
+    accuracy_mean = ont_params.get("accuracy_mean") or 0.95
 
-    # Warn if model file doesn't look like an ONT model
+    # Validate model file looks like an ONT model
     model_name = Path(model_file).name.upper()
     if "ONT" not in model_name and "NANOPORE" not in model_name:
         logging.warning(
             "ONT amplicon mode is using model file '%s' which does not appear "
-            "to be an ONT model. Consider using --model-file with an ONT model "
-            "(e.g., ERRHMM-ONT.model or QSHMM-ONT-HQ.model).",
+            "to be an ONT model. The default is ERRHMM-ONT.model. "
+            "Check ont_amplicon_params.model_file in config or use --model-file.",
             model_file,
         )
 
@@ -111,10 +112,7 @@ def simulate_ont_amplicon_pipeline(
         expected_range_tuple = (int(expected_range[0]), int(expected_range[1]))
 
     _rs_cov = rs_config.get("coverage")
-    _pb_cov = pacbio_params.get("coverage")
-    total_coverage: int = int(
-        _rs_cov if _rs_cov is not None else (_pb_cov if _pb_cov is not None else 30)
-    )
+    total_coverage: int = int(_rs_cov if _rs_cov is not None else 30)
 
     pcr_bias_config = amplicon_params.get("pcr_bias", {})
 

muc_one_up/type_defs.py

@@ -220,6 +220,16 @@ class PacbioConfig(TypedDict, total=False):
     length_max: int
 
 
+class OntAmpliconConfig(TypedDict, total=False):
+    """ONT amplicon simulation parameters (pbsim3 single-pass mode)."""
+
+    model_type: str
+    model_file: str
+    threads: int
+    seed: int | None
+    accuracy_mean: float
+
+
 # ---------------------------------------------------------------------------
 # Legacy aliases (kept for backward compatibility)
 # ---------------------------------------------------------------------------

tests/cli/test_amplicon_platform.py

@@ -69,6 +69,14 @@ def test_platform_ont_sets_ont_amplicon(tmp_path):
     assert config["read_simulation"]["simulator"] == "ont-amplicon"
 
 
+def test_ont_platform_uses_ont_amplicon_params(tmp_path):
+    """--platform ont should populate ont_amplicon_params, not pacbio_params."""
+    config = _invoke_amplicon(tmp_path, platform="ont")
+    assert "ont_amplicon_params" in config
+    # Default ONT model should be set
+    assert "ONT" in config["ont_amplicon_params"]["model_file"].upper()
+
+
 def test_assay_type_set_for_both_platforms(tmp_path):
     """Both platforms should set assay_type='amplicon'."""
     for platform in [None, "ont"]:

tests/read_simulator/test_ont_amplicon_pipeline.py

@@ -32,7 +32,7 @@ def ont_amplicon_config(tmp_path, muc1_primers):
             "reverse_primer": muc1_primers["reverse"],
             "pcr_bias": {"preset": "default"},
         },
-        "pacbio_params": {
+        "ont_amplicon_params": {
             "model_type": "errhmm",
             "model_file": str(model_file),
             "threads": 4,
@@ -192,7 +192,9 @@ def test_warns_on_non_ont_model(
         import logging
 
         # Use a PacBio model name to trigger warning
-        ont_amplicon_config["pacbio_params"]["model_file"] = str(tmp_path / "ERRHMM-SEQUEL.model")
+        ont_amplicon_config["ont_amplicon_params"]["model_file"] = str(
+            tmp_path / "ERRHMM-SEQUEL.model"
+        )
         (tmp_path / "ERRHMM-SEQUEL.model").write_text("model")
 
         mock_prep.return_value = _make_prep(tmp_path)