berntpopp · berntpopp · Apr 7, 2026 · Apr 7, 2026
diff --git a/.gitignore b/.gitignore
@@ -209,3 +209,4 @@ docs/archive/
 # codex
 .codex
 .worktrees/
+config_experiment.json
diff --git a/config.json b/config.json
@@ -531,16 +531,19 @@
     "threads": 8
   },
   "ont_amplicon_params": {
-    "model_type": "errhmm",
-    "model_file": "reference/pbsim3/ERRHMM-ONT.model",
+    "model_type": "qshmm",
+    "model_file": "reference/pbsim3/QSHMM-ONT-HQ.model",
     "threads": 8,
     "accuracy_mean": 0.95
   },
   "amplicon_params": {
     "forward_primer": "GGAGAAAAGGAGACTTCGGCTACCCAG",
     "reverse_primer": "GCCGTTGTGCACCAGAGTAGAAGCTGA",
     "primer_source": "Wenzel et al. 2018 (PMID: 29520014)",
-    "expected_product_range": [500, 15000],
+    "expected_product_range": [
+      500,
+      15000
+    ],
     "pcr_bias": {
       "preset": "default"
     }
@@ -634,7 +637,11 @@
     "consensus_motif": "RCHLGPGHQAGPGLHR",
     "identity_threshold": 0.8,
     "expected_repeat_count": 10,
-    "key_residues": ["R", "C", "H"],
+    "key_residues": [
+      "R",
+      "C",
+      "H"
+    ],
     "weights": {
       "repeat": 0.6,
       "composition": 0.4

diff --git a/docs/about/changelog.md b/docs/about/changelog.md
@@ -14,7 +14,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 - CLI routes `--model-file` overrides to `ont_amplicon_params` for ONT and `pacbio_params` for PacBio
 
 ### Added
-- `ont_amplicon_params` config section with ONT-specific defaults (ERRHMM-ONT.model)
+- `ont_amplicon_params` config section with ONT-specific defaults (QSHMM-ONT-HQ.model)
 - `OntAmpliconConfig` TypedDict for type-safe ONT parameter access
 - Config schema validation and path resolution for `ont_amplicon_params`
 - Test for ONT platform using `ont_amplicon_params` (not `pacbio_params`)

diff --git a/docs/guides/amplicon-simulation.md b/docs/guides/amplicon-simulation.md
@@ -44,7 +44,7 @@ muconeup --config config.json reads amplicon \
 # 2b. ONT amplicon reads
 muconeup --config config.json reads amplicon --platform ont \
   output/sample.001.simulated.fa \
-  --model-file /path/to/ERRHMM-ONT-HQ.model \
+  --model-file /path/to/QSHMM-ONT-HQ.model \
   --coverage 500 --seed 42
 ```
 
@@ -101,7 +101,7 @@ muconeup --config config.json reads amplicon sample.fa \
 
 # Oxford Nanopore
 muconeup --config config.json reads amplicon --platform ont sample.fa \
-  --model-file /path/to/ERRHMM-ONT-HQ.model
+  --model-file /path/to/QSHMM-ONT-HQ.model
 ```
 
 Stages 1-4 (extraction, PCR bias, template generation) are shared. The platforms differ in read generation and alignment:
@@ -112,7 +112,7 @@ Stages 1-4 (extraction, PCR bias, template generation) are shared. The platforms
 | pbsim3 pass_num | 3+ (multi-pass CLR) | 1 (single-pass) |
 | Consensus | CCS (multi-pass -> HiFi) | None (skip) |
 | minimap2 preset | `map-hifi` | `map-ont` |
-| Error model | `QSHMM-SEQUEL.model` etc. | `ERRHMM-ONT.model` etc. |
+| Error model | `QSHMM-SEQUEL.model` etc. | `QSHMM-ONT-HQ.model` etc. |
 | Output suffix | `*_amplicon_hifi.bam` | `*_amplicon_ont.bam` |
 | Tool dependencies | pbsim3, ccs, samtools, minimap2 | pbsim3, samtools, minimap2 |
 
@@ -125,23 +125,23 @@ The ONT amplicon pipeline reads from the `ont_amplicon_params` config section (s
 
 ```json
 "ont_amplicon_params": {
-    "model_type": "errhmm",
-    "model_file": "reference/pbsim3/ERRHMM-ONT.model",
+    "model_type": "qshmm",
+    "model_file": "reference/pbsim3/QSHMM-ONT-HQ.model",
     "threads": 8,
     "accuracy_mean": 0.95
 }
 ```
 
 | Parameter | Type | Default | Description |
 |-----------|------|---------|-------------|
-| `model_type` | string | `"errhmm"` | pbsim3 model type (`errhmm` or `qshmm`) |
-| `model_file` | string | `ERRHMM-ONT.model` | pbsim3 ONT error model file |
+| `model_type` | string | `"qshmm"` | pbsim3 model type (`errhmm` or `qshmm`) |
+| `model_file` | string | `QSHMM-ONT-HQ.model` | pbsim3 ONT error model file |
 | `threads` | int | `8` | Number of threads |
 | `accuracy_mean` | float | `0.95` | Mean read accuracy |
 
 Available ONT models in `reference/pbsim3/`:
 
-- `ERRHMM-ONT.model` -- standard ONT error profile
+- `QSHMM-ONT-HQ.model` -- standard ONT error profile
 - `QSHMM-ONT.model` -- quality score ONT model
 - `QSHMM-ONT-HQ.model` -- high-quality ONT model (e.g., Kit14/Dorado)
 

diff --git a/docs/reference/configuration.md b/docs/reference/configuration.md
@@ -607,8 +607,8 @@ Parameters for ONT amplicon read simulation (pbsim3 single-pass mode). Separate
 ```json
 {
   "ont_amplicon_params": {
-    "model_type": "errhmm",
-    "model_file": "reference/pbsim3/ERRHMM-ONT.model",
+    "model_type": "qshmm",
+    "model_file": "reference/pbsim3/QSHMM-ONT-HQ.model",
     "threads": 8,
     "accuracy_mean": 0.95
   }
@@ -619,13 +619,13 @@ Parameters for ONT amplicon read simulation (pbsim3 single-pass mode). Separate
 
 | Field | Type | Description | Default |
 |-------|------|-------------|---------|
-| `model_type` | string | "qshmm" or "errhmm" | "errhmm" |
-| `model_file` | string | pbsim3 ONT error model file | ERRHMM-ONT.model |
+| `model_type` | string | "qshmm" or "errhmm" | "qshmm" |
+| `model_file` | string | pbsim3 ONT error model file | QSHMM-ONT-HQ.model |
 | `threads` | number | Parallel threads (minimum 1) | 8 |
 | `seed` | integer | Random seed (null = random) | null |
 | `accuracy_mean` | number | Mean read accuracy (0.0-1.0) | 0.95 |
 
-Available ONT models: `ERRHMM-ONT.model`, `QSHMM-ONT.model`, `QSHMM-ONT-HQ.model`.
+Available ONT models: `QSHMM-ONT-HQ.model`, `QSHMM-ONT.model`, `QSHMM-ONT-HQ.model`.
 
 ---
 
@@ -784,8 +784,8 @@ See the [Amplicon Simulation Guide](../guides/amplicon-simulation.md) for detail
   },
 
   "ont_amplicon_params": {
-    "model_type": "errhmm",
-    "model_file": "/path/to/pbsim3/ERRHMM-ONT.model",
+    "model_type": "qshmm",
+    "model_file": "/path/to/pbsim3/QSHMM-ONT-HQ.model",
     "threads": 8,
     "accuracy_mean": 0.95
   }

diff --git a/muc_one_up/cli/commands/reads.py b/muc_one_up/cli/commands/reads.py
@@ -146,7 +146,7 @@ def _apply_ont_amplicon_params(
 
     Mutates config in place. Uses ont_amplicon_params section (separate
     from pacbio_params) so the ONT pipeline gets an ONT-specific model.
-    Falls back to sensible defaults (ERRHMM-ONT.model) when values are
+    Falls back to sensible defaults (QSHMM-ONT-HQ.model) when values are
     missing or explicitly null.
     """
     if "ont_amplicon_params" not in config:
@@ -161,12 +161,12 @@ def _apply_ont_amplicon_params(
         params["seed"] = seed
         logging.info("Using random seed: %d (results will be reproducible)", seed)
 
-    # Default to ERRHMM-ONT.model if missing or explicitly null
+    # Default to QSHMM-ONT-HQ.model if missing or explicitly null
     if not params.get("model_file"):
-        params["model_file"] = "reference/pbsim3/ERRHMM-ONT.model"
+        params["model_file"] = "reference/pbsim3/QSHMM-ONT-HQ.model"
         logging.info("Using default ONT model: %s", params["model_file"])
     if not params.get("model_type"):
-        params["model_type"] = "errhmm"
+        params["model_type"] = "qshmm"
 
 
 def _apply_pacbio_params(
@@ -560,7 +560,7 @@ def amplicon(
 
       # ONT amplicon simulation
       muconeup --config X reads amplicon --platform ont sample.fa \\
-        --model-file /models/ERRHMM-ONT.model
+        --model-file /models/QSHMM-ONT-HQ.model
 
       # High coverage with stochastic PCR bias
       muconeup --config X reads amplicon sample.fa \\

diff --git a/muc_one_up/read_simulator/ont_amplicon_pipeline.py b/muc_one_up/read_simulator/ont_amplicon_pipeline.py
@@ -83,8 +83,8 @@ def simulate_ont_amplicon_pipeline(
 
     # ONT-specific params — uses ont_amplicon_params (NOT pacbio_params)
     # Treat None as missing (possible from partial configs with explicit nulls)
-    model_type = ont_params.get("model_type") or "errhmm"
-    model_file = ont_params.get("model_file") or "reference/pbsim3/ERRHMM-ONT.model"
+    model_type = ont_params.get("model_type") or "qshmm"
+    model_file = ont_params.get("model_file") or "reference/pbsim3/QSHMM-ONT-HQ.model"
     threads = ont_params.get("threads") or 8
     seed = ont_params.get("seed")  # None is valid here (random seed)
     accuracy_mean = ont_params.get("accuracy_mean") or 0.95
@@ -94,7 +94,7 @@ def simulate_ont_amplicon_pipeline(
     if "ONT" not in model_name and "NANOPORE" not in model_name:
         logging.warning(
             "ONT amplicon mode is using model file '%s' which does not appear "
-            "to be an ONT model. The default is ERRHMM-ONT.model. "
+            "to be an ONT model. The default is QSHMM-ONT-HQ.model. "
             "Check ont_amplicon_params.model_file in config or use --model-file.",
             model_file,
         )

diff --git a/tests/read_simulator/test_ont_amplicon_pipeline.py b/tests/read_simulator/test_ont_amplicon_pipeline.py
@@ -19,7 +19,7 @@ def muc1_primers():
 
 @pytest.fixture
 def ont_amplicon_config(tmp_path, muc1_primers):
-    model_file = tmp_path / "ERRHMM-ONT-HQ.model"
+    model_file = tmp_path / "QSHMM-ONT-HQ.model"
     model_file.write_text("model")
     return {
         "tools": {
@@ -33,7 +33,7 @@ def ont_amplicon_config(tmp_path, muc1_primers):
             "pcr_bias": {"preset": "default"},
         },
         "ont_amplicon_params": {
-            "model_type": "errhmm",
+            "model_type": "qshmm",
             "model_file": str(model_file),
             "threads": 4,
         },
-Original file line number
+Diff line change
@@ Expand Up / @@ -209,3 +209,4 @@ docs/archive/ @@
     # codex
     .codex
     .worktrees/
+    config_experiment.json