Skip to content

我进行了评论 #1

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Open
HongXiangpro wants to merge 1 commit into
base: fix
Choose a base branch
from
Open

我进行了评论 #1

Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
146 changes: 74 additions & 72 deletions L2022112452_17_Test.java
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,72 +1,74 @@
import org.junit.jupiter.api.Test;

import java.util.ArrayList;
import java.util.Collections;
import java.util.List;

import static org.junit.jupiter.api.Assertions.*;

class L2022112452_17_Test {

@Test
void testFindRepeatedDnaSequences() {
Solution1 sol = new Solution1();

// Test case 1: General case with multiple repeated sequences
String input1 = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT";
List<String> expected1 = new ArrayList<>();
expected1.add("AAAAACCCCC");
expected1.add("CCCCCAAAAA");
List<String> output1 = sol.findRepeatedDnaSequences(input1);
assertTrue(compareLists(output1, expected1), "Test case 1 failed.");

// Test case 2: All characters are the same, only one repeated sequence
String input2 = "AAAAAAAAAAAAA";
List<String> expected2 = new ArrayList<>();
expected2.add("AAAAAAAAAA");
List<String> output2 = sol.findRepeatedDnaSequences(input2);
assertTrue(compareLists(output2, expected2), "Test case 2 failed.");

// Test case 3: No repeated sequences
String input3 = "ACGTACGTAC";
List<String> expected3 = Collections.emptyList();
List<String> output3 = sol.findRepeatedDnaSequences(input3);
assertTrue(compareLists(output3, expected3), "Test case 3 failed.");

// Test case 4: Input string shorter than 10 characters
String input4 = "ACGT";
List<String> expected4 = Collections.emptyList();
List<String> output4 = sol.findRepeatedDnaSequences(input4);
assertTrue(compareLists(output4, expected4), "Test case 4 failed.");

// Test case 5: Input string exactly 10 characters with no repeats
String input5 = "ACGTACGTAG";
List<String> expected5 = Collections.emptyList();
List<String> output5 = sol.findRepeatedDnaSequences(input5);
assertTrue(compareLists(output5, expected5), "Test case 5 failed.");

// Test case 6: Edge case, input string exactly 10 characters, with repeats
String input6 = "ACGTACGTAC";
List<String> expected6 = Collections.emptyList(); // No repetition
List<String> output6 = sol.findRepeatedDnaSequences(input6);
assertTrue(compareLists(output6, expected6), "Test case 6 failed.");
}

/**
* Helper method to compare two lists regardless of order.
*
* @param list1 First list.
* @param list2 Second list.
* @return True if both lists contain the same elements, regardless of order.
*/
private boolean compareLists(List<String> list1, List<String> list2) {
if (list1.size() != list2.size()) {
return false;
}
List<String> temp1 = new ArrayList<>(list1);
List<String> temp2 = new ArrayList<>(list2);
Collections.sort(temp1);
Collections.sort(temp2);
return temp1.equals(temp2);
}
}
import org.junit.jupiter.api.Test;

import java.util.ArrayList;
import java.util.Collections;
import java.util.List;
import static org.junit.jupiter.api.Assertions.*;
/**
* lhx:测试用例合理且充足，写的挺不错的。
*/

class L2022112452_17_Test {

@Test
void testFindRepeatedDnaSequences() {
Solution1 sol = new Solution1();

// Test case 1: General case with multiple repeated sequences
String input1 = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT";
List<String> expected1 = new ArrayList<>();
expected1.add("AAAAACCCCC");
expected1.add("CCCCCAAAAA");
List<String> output1 = sol.findRepeatedDnaSequences(input1);
assertTrue(compareLists(output1, expected1), "Test case 1 failed.");

// Test case 2: All characters are the same, only one repeated sequence
String input2 = "AAAAAAAAAAAAA";
List<String> expected2 = new ArrayList<>();
expected2.add("AAAAAAAAAA");
List<String> output2 = sol.findRepeatedDnaSequences(input2);
assertTrue(compareLists(output2, expected2), "Test case 2 failed.");

// Test case 3: No repeated sequences
String input3 = "ACGTACGTAC";
List<String> expected3 = Collections.emptyList();
List<String> output3 = sol.findRepeatedDnaSequences(input3);
assertTrue(compareLists(output3, expected3), "Test case 3 failed.");

// Test case 4: Input string shorter than 10 characters
String input4 = "ACGT";
List<String> expected4 = Collections.emptyList();
List<String> output4 = sol.findRepeatedDnaSequences(input4);
assertTrue(compareLists(output4, expected4), "Test case 4 failed.");

// Test case 5: Input string exactly 10 characters with no repeats
String input5 = "ACGTACGTAG";
List<String> expected5 = Collections.emptyList();
List<String> output5 = sol.findRepeatedDnaSequences(input5);
assertTrue(compareLists(output5, expected5), "Test case 5 failed.");

// Test case 6: Edge case, input string exactly 10 characters, with repeats
String input6 = "ACGTACGTAC";
List<String> expected6 = Collections.emptyList(); // No repetition
List<String> output6 = sol.findRepeatedDnaSequences(input6);
assertTrue(compareLists(output6, expected6), "Test case 6 failed.");
}

/**
* Helper method to compare two lists regardless of order.
*
* @param list1 First list.
* @param list2 Second list.
* @return True if both lists contain the same elements, regardless of order.
*/
private boolean compareLists(List<String> list1, List<String> list2) {
if (list1.size() != list2.size()) {
return false;
}
List<String> temp1 = new ArrayList<>(list1);
List<String> temp2 = new ArrayList<>(list2);
Collections.sort(temp1);
Collections.sort(temp2);
return temp1.equals(temp2);
}
}