Erick Lu
March 1, 2020
- Introduction
- Obtaining raw data from GEO
- Mapping reads using STAR
- Differential expression analysis
- Visualizations for sample variability
- Making subsetted DESeq2 objects
- Extracting DE results
- Visualizations for DE results
- Conclusion
RNA-sequencing is a powerful technique that can assess differences in global gene expression between groups of samples. For example, it can be used to:
- Identify differences between knockout and control samples
- Understand the effects of treating cells/animals with therapeutics
- Observe the gene expression changes that occur across development
However, processing raw sequencing data and performing differential gene expression analysis can be daunting for researchers with limited experience in programming. My goal is to help researchers learn how to analyze bulk RNA-sequencing data by providing code, explanations, and the expected output for each step of the process. Here, I present an example of a complete bulk RNA-sequencing pipeline which includes:
- Finding and downloading raw data from GEO using NCBI SRA tools and Python
- Mapping FASTQ files using STAR
- Differential gene expression analysis using DESeq2
- Visualizations for bulk RNA-seq results
If you are performing your own RNA-seq experiment and have obtained raw data from your sequencing facility, you can start this guide from the section: Mapping reads using STAR.
The dataset that we will be working with comes from Guo et al. Nature Communications 2019. To find the raw sequencing data, we can navigate through the Gene Expression Omnibus (GEO) using the accession number provided in the publication: GSE106305. The GEO page corresponding to this accession number is https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE106305. On this webpage, there is information about where the sequencing data for each sample in the study is stored.
Our goal is to find differentially expressed genes in response to hypoxia for the LNCaP and PC3 cell lines. Therefore, we will select the control samples for both cell lines (Empty_Vector for LNCaP and siCtrl for PC3) in conditions of either normoxia or hypoxia. The specific samples we need to download are outlined in the table below:
| Sample Name | GSM Identifier | SRA Identifier (SRX) | SRA Runs (SRR, download these) |
|---|---|---|---|
| LNCaP_RNA-Seq_Empty_Vector_Normoxia_rep1 | GSM3145509 | SRX4096735 | SRR7179504, SRR7179505, SRR7179506, and SRR7179507 |
| LNCaP_RNA-Seq_Empty_Vector_Normoxia_rep2 | GSM3145510 | SRX4096736 | SRR7179508, SRR7179509, SRR7179510, and SRR7179511 |
| LNCaP_RNA-Seq_Empty_Vector_Hypoxia_rep1 | GSM3145513 | SRX4096739 | SRR7179520, SRR7179521, SRR7179522, and SRR7179523 |
| LNCaP_RNA-Seq_Empty_Vector_Hypoxia_rep2 | GSM3145514 | SRX4096740 | SRR7179524, SRR7179525, SRR7179526, and SRR7179527 |
| PC3_RNA-Seq_siCtrl_Normoxia_rep1 | GSM3145517 | SRX4096743 | SRR7179536 |
| PC3_RNA-Seq_siCtrl_Normoxia_rep2 | GSM3145518 | SRX4096744 | SRR7179537 |
| PC3_RNA-Seq_siCtrl_Hypoxia_rep1 | GSM3145521 | SRX4096747 | SRR7179540 |
| PC3_RNA-Seq_siCtrl_Hypoxia_rep2 | GSM3145522 | SRX4096748 | SRR7179541 |
The NCBI stores sequencing data in the form of Sequence Read Archive (SRA) files. Each of the samples is associated with a set of SRA accession numbers, indicated above. First, we need to download the SRA runs for each sample. Then, we will use the SRA files to generate FASTQ files. The FASTQ file is the data format required for bulk RNA-sequencing analysis.
To download the SRA files onto our machine, we will use the NCBI’s SRA
toolkit. If you are using linux, you can type:
sudo apt install sra-toolkit in your command line to install the
toolkit. You can read more about SRA toolkit here:
https://www.ncbi.nlm.nih.gov/books/NBK242621/.
The toolkit works by first using the prefetch command to download the
SRA file associated with the specified SRA ID. The SRA file contains a
set of “instructions” for downloading the sequencing data associated
with the SRA ID from NCBI. For example, to download the first SRA run
for LNCaP_RNA-Seq_Empty_Vector_Normoxia_rep1, we would write:
prefetch SRR7179504
2020-02-14T22:15:36 prefetch.2.8.2: 1) Downloading 'SRR7179504'...
2020-02-14T22:15:36 prefetch.2.8.2: Downloading via https...
2020-02-14T22:18:39 prefetch.2.8.2: 1) 'SRR7179504' was downloaded successfully
2020-02-14T22:18:39 prefetch.2.8.2: 'SRR7179504' has 0 unresolved dependencies
This will download the file SRR7179504.sra into our home directory at
~/ncbi/public/sra/. We can now use fastq-dump to extract the contents
of it into a FASTQ file. The Edwards lab at SDSU provides a nice
tutorial for how to use fastq-dump here:
https://edwards.sdsu.edu/research/fastq-dump/.
To create the FASTQ file for SRR7179504, we would write:
fastq-dump --outdir fastq --gzip --skip-technical --readids --read-filter pass --dumpbase --split-3 --clip ~/ncbi/public/sra/SRR7179504.sra
Rejected 13548432 READS because of filtering out non-biological READS
Read 13548432 spots for /home/ericklu/ncbi/public/sra/SRR7179504.sra
Written 13548432 spots for /home/ericklu/ncbi/public/sra/SRR7179504.sra
This will create a file called SRR7179504_pass.fastq.gz in a
subdirectory called fastq inside the directory where fastq-dump was
called. The “.gz” just means that the file is compressed.
Since there are many SRA runs associated with our samples, it would take
a long time to manually run prefetch and fastq-dump for each run. To
automate all the downloads, I wrote a small script in Python to call
fastq-dump on each of the SRA runs we want. The code is shown below
and also provided in this repo as fastq_download.py:
import subprocess
sra_numbers = [
"SRR7179504", "SRR7179505", "SRR7179506", "SRR7179507",
"SRR7179508", "SRR7179509", "SRR7179510", "SRR7179511",
"SRR7179520", "SRR7179521", "SRR7179522", "SRR7179523",
"SRR7179524", "SRR7179525", "SRR7179526", "SRR7179527",
"SRR7179536", "SRR7179537", "SRR7179540","SRR7179541"
]
# this will download the .sra files to ~/ncbi/public/sra/ (will create directory if not present)
for sra_id in sra_numbers:
print ("Currently downloading: " + sra_id)
prefetch = "prefetch " + sra_id
print ("The command used was: " + prefetch)
subprocess.call(prefetch, shell=True)
# this will extract the .sra files from above into a folder named 'fastq'
for sra_id in sra_numbers:
print ("Generating fastq for: " + sra_id)
fastq_dump = "fastq-dump --outdir fastq --gzip --skip-technical --readids --read-filter pass --dumpbase --split-3 --clip ~/ncbi/public/sra/" + sra_id + ".sra"
print ("The command used was: " + fastq_dump)
subprocess.call(fastq_dump, shell=True)
We can run the Python script by simply navigating to the folder on your
machine where you want to store the FASTQ files (via the command line),
then running python fastq_download.py. After running the Python
script, all the FASTQ files should be sitting in a directory called
‘fastq’. If you would like more information about navigating through GEO
and downloading SRA Runs, you can check out my other
repo.
Each of the LNCaP samples was associated with four SRA runs, which means
that we obtained four resulting FASTQ files for each sample after
running fastq_download.py. For each sample, we should concatenate the
four files into a single FASTQ file by using the command cat. Below, I
perform the concatenation for each of the LNCaP samples:
cat SRR7179504_pass.fastq.gz SRR7179505_pass.fastq.gz SRR7179506_pass.fastq.gz SRR7179507_pass.fastq.gz > LNCAP_Normoxia_S1.fastq.gz
cat SRR7179508_pass.fastq.gz SRR7179509_pass.fastq.gz SRR7179510_pass.fastq.gz SRR7179511_pass.fastq.gz > LNCAP_Normoxia_S2.fastq.gz
cat SRR7179520_pass.fastq.gz SRR7179521_pass.fastq.gz SRR7179522_pass.fastq.gz SRR7179523_pass.fastq.gz > LNCAP_Hypoxia_S1.fastq.gz
cat SRR7179524_pass.fastq.gz SRR7179525_pass.fastq.gz SRR7179526_pass.fastq.gz SRR7179527_pass.fastq.gz > LNCAP_Hypoxia_S2.fastq.gz
In contrast, there is only one FASTQ file for each of the PC3 samples.
We can just rename them from their SRR identifiers to their real sample
names using mv:
mv SRR7179536_pass.fastq.gz PC3_Normoxia_S1.fastq.gz
mv SRR7179537_pass.fastq.gz PC3_Normoxia_S2.fastq.gz
mv SRR7179540_pass.fastq.gz PC3_Hypoxia_S1.fastq.gz
mv SRR7179541_pass.fastq.gz PC3_Hypoxia_S2.fastq.gz
We won’t need the individual SRA runs anymore, so we can remove them all
using the command rm SRR*, which removes all the files in the folder
that begin with “SRR”. Now, the folder should contain a total of 8 FASTQ
files: 4 for LNCaP and 4 for PC3. We are ready to begin aligning these
FASTQ files to the reference genome!
Each read in your FASTQ file must be “mapped” to a reference genome. “Mapping” can be described as finding the place in the reference genome that best matches the fragment of the mRNA transcript captured in the read. In this section, I will describe the concepts behind mapping reads to a reference genome, and how to do it using the tool STAR (Spliced Transcripts Alignment to a Reference, https://github.com/alexdobin/STAR) and some Python scripting.
In order to perform bulk RNA-sequencing, a “library” must first be prepared from the RNA of your cells of interest. This library is sequenced to create the FASTQ files. To create a library, mRNA from the cells is first captured and reverse transcribed into cDNA. This is then fragmented into small pieces, and sequencing adaptors are attached to the ends of each fragment to create the library. A sequencer will “read” these fragments and store the sequences in a FASTQ file. We can observe what the sequences look like by printing out one of the “reads”, which are stored in 4-line chunks inside the FASTQ file.
zcat LNCAP_Hypoxia_S1.fastq.gz | head -4
@SRR7179520.1.1 1 length=76
GTGAANATAGGCCTTAGAGCACTTGANGTGNTAGNGCANGTNGNNCCGGAACGNNNNNNNNAGGTNGNNNGNGTTG
+SRR7179520.1.1 1 length=76
AAAAA#EEEEEEEEEEEEEEEEEEEE#EEE#EEE#EEE#EE#E##EEEEEEEE########EEEE#E###E#EAEA
Each line of the read contains a different set of information:
- Line 1 contains a sequence identifier with an optional description. This line must start with “@”.
- Line 2 contains the actual sequence of the read.
- Line 3 must start with “+”, and usually contains the same sequence identifier as line 1. Having the identifier is not required, and sometimes this line consists of just a single “+”.
- Line 4 contains quality values for each base designation from ine 2. For example, the first base “G” has a quality value of “A”. This is basically an assessment of how confident the machine is that it assigned the right base.
Using the sequence for each fragment (line 3), we can use software to figure out which part of the genome that fragment originally came from, based on sequence similarity. This tells us which gene was being transcribed to create the original mRNA that was captured to make the library. Counting the number of times a read mapped to a specific gene gives us information about how “high” or “low” a gene was being expressed.
A great tool for mapping reads is STAR. In order to install STAR, follow the installation instructions provided in its GitHub repo. I will be using version 2.7.0e. Once STAR is installed, we need to first build a genome index. Since we are analyzing RNA-seq data from human cells, we will build the human reference genome.
To build the genome index, we have to run STAR in --genomeGenerate
mode and supply it with the human reference genome sequence (FASTA) and
annotation (GTF) files. We can download the FASTA and GTF files from the
Ensembl website
(https://uswest.ensembl.org/Homo_sapiens/Info/Index)
using the command line:
wget ftp://ftp.ensembl.org/pub/release-99/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz
wget ftp://ftp.ensembl.org/pub/release-99/gtf/homo_sapiens/Homo_sapiens.GRCh38.99.gtf.gz
gunzip *.gz
Once these are downloaded and unzipped, we can run the command below to
make the genome index file. For the --genomeDir parameter, you should
specify the directory where you are keeping the FASTA and GTF files.
STAR --runThreadN 64 --runMode genomeGenerate --genomeDir /data/genomes/h38/STAR/ --genomeFastaFiles /data/genomes/h38/STAR/Homo_sapiens.GRCh38.dna.primary_assembly.fa --sjdbGTFfile /data/genomes/h38/STAR/Homo_sapiens.GRCh38.99.gtf
The output from successfully running the command looks like:
Feb 15 20:06:34 ..... started STAR run
Feb 15 20:06:34 ... starting to generate Genome files
Feb 15 20:07:28 ... starting to sort Suffix Array. This may take a long time...
Feb 15 20:07:41 ... sorting Suffix Array chunks and saving them to disk...
Feb 15 20:20:11 ... loading chunks from disk, packing SA...
Feb 15 20:21:15 ... finished generating suffix array
Feb 15 20:21:15 ... generating Suffix Array index
Feb 15 20:25:16 ... completed Suffix Array index
Feb 15 20:25:16 ..... processing annotations GTF
Feb 15 20:25:26 ..... inserting junctions into the genome indices
Feb 15 20:27:58 ... writing Genome to disk ...
Feb 15 20:28:01 ... writing Suffix Array to disk ...
Feb 15 20:28:18 ... writing SAindex to disk
Feb 15 20:28:20 ..... finished successfully
After running the command, you should see a bunch of genome index files
in the directory specified by --genomeDir. We can now start mapping
reads from the FASTQ files to this newly-created reference genome, which
I will explain in the next section.
Here is an example STAR command used to map a single sample, LNCAP_Normoxia_S1_R1_001.fastq.gz, to the reference genome:
STAR --runThreadN 64 --genomeDir /data/genomes/h38/STAR --outFilterType BySJout --outFilterMismatchNoverLmax 0.04 --outFilterMismatchNmax 999 --alignSJDBoverhangMin 1 --alignSJoverhangMin 8 --outFilterMultimapNmax 20 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --readFilesIn /fastq/LNCAP_Normoxia_S1_R1_001.fastq.gz --clip3pAdapterSeq GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --outSAMtype BAM SortedByCoordinate --quantMode GeneCounts --outFileNamePrefix LNCAP_Normoxia_S1
The parameters that you should pay attention to are:
--genomeDir, which indicates the directory that contains the genome index files--readFilesIn, which specifies the FASTQ file location for sample LNCAP_Normoxia_S1_R1_001.fastq.gz--outFileNamePrefix, which specifies the name we want to give the STAR output
The rest of the parameters are default settings recommended by STAR, which are usually sufficient. Since we have 8 samples to run, and each sample will take a long time to run, we can use a Python script to run the command for each FASTQ in the directory:
import subprocess
import os
output_directory = "STAR_output/"
genome_directory = "/data/genomes/h38/STAR/"
fastq_directory = "/data/analysis/hypoxia/fastq/"
os.mkdir(output_directory)
for fastq in os.listdir(fastq_directory):
# only process files that end in fastq.gz
if fastq.endswith('.fastq.gz'):
prefix=fastq.strip(".fastq.gz") + "_output"
# make an output folder for the current fastq file
os.mkdir(output_directory + prefix)
print ("Currently mapping: " + fastq)
# run STAR on the current fastq file
subprocess.call("STAR --runThreadN 64 --genomeDir " + genome_directory + " --readFilesCommand zcat --outFilterType BySJout --outFilterMismatchNoverLmax 0.04 --outFilterMismatchNmax 999 --alignSJDBoverhangMin 1 --alignSJoverhangMin 8 --outFilterMultimapNmax 20 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --readFilesIn "+ fastq_directory + fastq + " --clip3pAdapterSeq GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --outSAMtype BAM SortedByCoordinate --quantMode GeneCounts --outFileNamePrefix " + output_directory + prefix + "/", shell=True)
We can save the script as align_STAR.py, and run the script by simply
typing python align_STAR.py in the command line. The output of a
successful STAR alignment looks like this, for one iteration of the
loop:
Currently mapping: PC3_Normoxia_S1.fastq.gz
Feb 16 23:28:42 ..... started STAR run
Feb 16 23:28:42 ..... loading genome
Feb 16 23:28:59 ..... started mapping
Feb 16 23:31:07 ..... finished mapping
Feb 16 23:31:10 ..... started sorting BAM
Feb 16 23:32:59 ..... finished successfully
After the script has finished running, the output folders containing the
alignment files for each sample should be found in the directory
STAR_output/.
In the STAR_output/ directory, you will find a separate folder of
results for each of the FASTQ files you mapped. Inside each folder, you
should see the following files:
Aligned.sortedByCoord.out.bam
Log.final.out
Log.out
Log.progress.out
ReadsPerGene.out.tab
SJ.out.tab
The file that contains the data you need is ReadsPerGene.out.tab. This
file contains the number of reads that were mapped to each gene in the
transcriptome. A quick glance at the file using the command below shows
the structure of the file. There are some QC metrics at the beginning of
the file (N_unmapped, etc.) followed by each gene in the transcriptome.
cat ReadsPerGene.out.tab | head -n 10
N_unmapped 2461926 2461926 2461926
N_multimapping 4255262 4255262 4255262
N_noFeature 4048236 41792820 4475290
N_ambiguous 3081395 50727 1691846
ENSG00000223972 0 0 0
ENSG00000227232 3 0 3
ENSG00000278267 13 0 13
ENSG00000243485 0 0 0
ENSG00000284332 0 0 0
ENSG00000237613 0 0 0
The first column corresponds to the Ensembl gene ID. Columns 2, 3, and 4 correspond to the number of reads mapped to each gene. You might be wondering why there are 3 columns of counts. Each column corresponds to the “strandedness” of the read mapping. An RNA-seq library is composed of DNA, which has two strands: a “sense” strand and an “anti-sense” strand. RNA-seq libraries can be prepared as either “unstranded” or “stranded”. The column you choose for downstream analysis is typically dictated by the strandedness of the library kit that was used to prepare the samples.
-
If an “unstranded” library prep kit was used, column 2 should be selected. For unstranded libraries, we don’t know which strand the original mRNA was produced from, and the reads are mapped to both the sense and anti-sense strand.
-
If a “stranded” library prep kit was used, we must choose from column 3 or 4. The information from which strand the mRNA originated from is retained. Column 3 corresponds to the first read strand aligned, and column 4 corresponds to the second read strand aligned.
To determine the strandedness for our samples, the we need to find out the exact library preparation kit that was used. The sample information at https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM3145522 states that the TruSeq® Stranded mRNA Library Prep Kit (RS-122-2101, Illumina) was used to prepare these samples. Since this is a stranded library prep kit, we must select from column 3 or 4. Looking at the output above, we observe that column 4 contains the reads whereas column 3 does not. We will proceed with using column 4 from each of the samples for downstream analysis.
For each of our samples, we need to select column 4 from
ReadsPerGene.out.tab and place them into one data file for downstream
analysis. Rather than doing this manually, we can write a Python script
to loop through each folder within STAR_output/, obtain column 4 of
the ReadsPerGene.out.tab, and write the data to a single output file.
The script combine_STAR_output.py does the job by storing the the
counts per gene for each sample in a dictionary of dictionaries, and
writes the aggregated data to a file called raw_counts.csv.
import os
import csv
# modify desired_column based on strandedness of library kit (index 3 is column 4)
desired_column = 3
output_directory = "STAR_output/"
sample_dict = {}
sample_names = []
# loop through each folder and store data from ReadsPerGene.out.tab in sample_dict
for folder in os.listdir(output_directory):
if folder.endswith("_output"):
file_name=folder.strip('_output')
sample_names.append(file_name)
gene_dict = {}
with open(output_directory + folder + "/ReadsPerGene.out.tab") as tabfile:
print("Column " + str(desired_column) + " of " + file_name + " stored")
reader = csv.reader(tabfile, delimiter = "\t")
for row in reader:
gene_dict[row[0]]=row[desired_column]
# store gene_dict for the current file in sample_dict
sample_dict[file_name] = gene_dict
# write sample_dict to output files
# the qc metrics are stored in qc.csv, and the gene counts are stored in raw_counts.csv
with open("raw_counts.csv", "wt") as counts_file, open("qc.csv", "wt") as qc_file:
counts_writer = csv.writer(counts_file)
qc_writer = csv.writer(qc_file)
counts_writer.writerow( ['ensembl_id']+ sample_names )
qc_writer.writerow( ['qc_metric']+ sample_names )
sorted_genes = sorted(list(sample_dict[sample_names[0]].keys()))
for gene in sorted_genes:
output=[gene]
for sample in sample_names:
output.append(sample_dict[sample][gene])
if gene.startswith("N_"):
qc_writer.writerow(output)
else:
counts_writer.writerow(output)
The first column of the output file raw_counts.csv is the Ensembl ID
of each of the genes in the transcriptome. The rest of the columns
correspond to the counts per gene for the 8 samples that we mapped.
Another file named qc.csv is created which contains the qc metrics
that were at the beginning of the ReadsPerGene.out.tab file for each
sample.
In order to perform differential gene expression analysis, we will be
using the R package DESeq2. This package provides a set of data
normalization and processing tools designed specifically for bulk
RNA-seq data and differential gene expression analysis. A great tutorial
that goes into the nitty-gritty details of DESeq2 can be found here:
https://www.bioconductor.org/packages/devel/bioc/vignettes/DESeq2/inst/doc/DESeq2.html.
In the sections below, I will use DESeq2 to determine the genes
upregulated by hypoxia in both LNCaP and PC3 cells. I also provide
custom functions and visualizations to streamline the analysis process
and gain further insight into the data.
We can install DESeq2 from Bioconductor using the following commands:
if (!requireNamespace("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("DESeq2")
Once installed, we will load the packages that are required for our
analysis. I will be using version 1.22.2 of DESeq2. The tidyverse
will be used to wrangle gene expression tables and create
visualizations.
library("DESeq2")
library("tidyverse")
We can now read in raw_counts.csv into R, and take a look at the
structure of the data:
data <- read.csv("raw_counts.csv", header = T, row.names = "ensembl_id")
data <- data[,sort(colnames(data))]
head(data)
## LNCAP_Hypoxia_S1 LNCAP_Hypoxia_S2 LNCAP_Normoxia_S1
## ENSG00000000003 609 693 374
## ENSG00000000005 0 0 0
## ENSG00000000419 4390 4918 4982
## ENSG00000000457 764 826 593
## ENSG00000000460 398 512 559
## ENSG00000000938 2 2 2
## LNCAP_Normoxia_S2 PC3_Hypoxia_S1 PC3_Hypoxia_S2 PC3_Normoxia_S1
## ENSG00000000003 388 1075 333 348
## ENSG00000000005 0 0 0 0
## ENSG00000000419 5766 3254 1030 1042
## ENSG00000000457 654 91 25 31
## ENSG00000000460 509 444 160 188
## ENSG00000000938 1 0 0 0
## PC3_Normoxia_S2
## ENSG00000000003 964
## ENSG00000000005 0
## ENSG00000000419 2438
## ENSG00000000457 101
## ENSG00000000460 471
## ENSG00000000938 1
We see that there are 60676 rows and 8 columns to the data, in which each row is a gene and each column corresponds to the reads per gene for each sample. We can quantify the total reads per sample by taking the column sums:
colSums(data)
## LNCAP_Hypoxia_S1 LNCAP_Hypoxia_S2 LNCAP_Normoxia_S1 LNCAP_Normoxia_S2
## 37480174 42634975 40046898 48555048
## PC3_Hypoxia_S1 PC3_Hypoxia_S2 PC3_Normoxia_S1 PC3_Normoxia_S2
## 37392717 12721451 12754721 37767688
We observe that each sample has been sequenced at a different “depth”,
in which there are varying numbers of total reads for each sample. For
example, PC3_Hypoxia_S2 has only 12 million reads, which is less than
1/3rd of the reads for PC3_Hypoxia_S1. This means that we cannot
directly compare the count values between samples without normalizing
each column based on its total read count. After the data have been
processed using DESeq2, we will have normalized data that we can use
to make comparisons.
To create the DESeq2 object, we can use the function
DESeqDataSetFromMatrix(), which requires three items:
countData- The data in the form of an integer matrix, in which the rownames correspond to the gene IDs. This is thedataobject that we created fromraw_counts.csv.colData- A table that provides the sample groups to be compared. It should also assign each sample to a group (i.e. biological replicates).design- A formula that dictates how the counts for each gene depend on the variables incolData. We will use the groups defined in colData.
To construct the colData, we first define the groups and how many
samples each group has:
# identify biological replicates
condition <- c(rep("LNCAP_Hypoxia", 2), rep("LNCAP_Normoxia", 2), rep("PC3_Hypoxia", 2), rep("PC3_Normoxia", 2))
Then, we assign individual sample names (corresponding to the column
names of raw_counts.csv) to the grouping categories by binding them
within a data frame:
# assign replicates to each sample name to construct colData
my_colData <- as.data.frame(condition)
rownames(my_colData) <- colnames(data)
my_colData
## condition
## LNCAP_Hypoxia_S1 LNCAP_Hypoxia
## LNCAP_Hypoxia_S2 LNCAP_Hypoxia
## LNCAP_Normoxia_S1 LNCAP_Normoxia
## LNCAP_Normoxia_S2 LNCAP_Normoxia
## PC3_Hypoxia_S1 PC3_Hypoxia
## PC3_Hypoxia_S2 PC3_Hypoxia
## PC3_Normoxia_S1 PC3_Normoxia
## PC3_Normoxia_S2 PC3_Normoxia
The vector above named condition can be used for the design
argument. Now that we have all the required inputs, we will create a
DESeq2 object (usually named dds) using DESeqDataSetFromMatrix():
dds <- DESeqDataSetFromMatrix(countData = data,
colData = my_colData,
design = ~condition)
This can then be processed using the function DESeq(), which will
perform differential expression analysis based on a negative binomial
distribution. From the
documentation,
this function will perform:
- estimation of size factors: estimateSizeFactors
- estimation of dispersion: estimateDispersions
- Negative Binomial GLM fitting and Wald statistics: nbinomWaldTest
dds <- DESeq(dds)
## estimating size factors
## estimating dispersions
## gene-wise dispersion estimates
## mean-dispersion relationship
## final dispersion estimates
## fitting model and testing
We can observe some basic information about the dds object just by
calling its name:
dds
## class: DESeqDataSet
## dim: 60676 8
## metadata(1): version
## assays(4): counts mu H cooks
## rownames(60676): ENSG00000000003 ENSG00000000005 ... ENSG00000288587
## ENSG00000288588
## rowData names(30): baseMean baseVar ... deviance maxCooks
## colnames(8): LNCAP_Hypoxia_S1 LNCAP_Hypoxia_S2 ... PC3_Normoxia_S1
## PC3_Normoxia_S2
## colData names(2): condition sizeFactor
We can also sift through the dds object using @ and $. For
example, we can find the raw counts data this way:
head(dds@assays@data$counts)
## LNCAP_Hypoxia_S1 LNCAP_Hypoxia_S2 LNCAP_Normoxia_S1
## ENSG00000000003 609 693 374
## ENSG00000000005 0 0 0
## ENSG00000000419 4390 4918 4982
## ENSG00000000457 764 826 593
## ENSG00000000460 398 512 559
## ENSG00000000938 2 2 2
## LNCAP_Normoxia_S2 PC3_Hypoxia_S1 PC3_Hypoxia_S2 PC3_Normoxia_S1
## ENSG00000000003 388 1075 333 348
## ENSG00000000005 0 0 0 0
## ENSG00000000419 5766 3254 1030 1042
## ENSG00000000457 654 91 25 31
## ENSG00000000460 509 444 160 188
## ENSG00000000938 1 0 0 0
## PC3_Normoxia_S2
## ENSG00000000003 964
## ENSG00000000005 0
## ENSG00000000419 2438
## ENSG00000000457 101
## ENSG00000000460 471
## ENSG00000000938 1
Another way to get the raw counts from the dds object is by using the
function counts(dds, normalized = F). If you want the normalized
counts instead, we set normalized = T. For example:
normalized_counts <- counts(dds, normalized = T)
head(normalized_counts)
## LNCAP_Hypoxia_S1 LNCAP_Hypoxia_S2 LNCAP_Normoxia_S1
## ENSG00000000003 332.132920 329.1677896 196.947687
## ENSG00000000005 0.000000 0.0000000 0.000000
## ENSG00000000419 2394.192973 2335.9988300 2623.511696
## ENSG00000000457 416.665930 392.3414058 312.272669
## ENSG00000000460 217.058953 243.1946728 294.368334
## ENSG00000000938 1.090749 0.9499792 1.053196
## LNCAP_Normoxia_S2 PC3_Hypoxia_S1 PC3_Hypoxia_S2 PC3_Normoxia_S1
## ENSG00000000003 165.0244594 1375.2607 1186.97279 1061.85621
## ENSG00000000005 0.0000000 0.0000 0.00000 0.00000
## ENSG00000000419 2452.3995699 4162.8821 3671.41735 3179.46601
## ENSG00000000457 278.1597847 116.4174 89.11207 94.59064
## ENSG00000000460 216.4882728 568.0146 570.31726 573.64646
## ENSG00000000938 0.4253208 0.0000 0.00000 0.00000
## PC3_Normoxia_S2
## ENSG00000000003 1113.540719
## ENSG00000000005 0.000000
## ENSG00000000419 2816.195304
## ENSG00000000457 116.667648
## ENSG00000000460 544.063982
## ENSG00000000938 1.155125
As you can see, the normalized counts are different in value than the raw counts, as expected. These normalized counts can be used to compare gene expression values between samples.
Right now, the genes are labeled using their Ensembl ID (e.g., ENSG00000111640). It would be nice to have each Ensembl ID translated into its gene name, so that we can search the data for our gene of interest without having to look up the Ensembl ID each time. We will also need to know the gene names for each Ensembl ID when generating visualizations and differential gene lists.
In order to map Ensembl IDs to their gene names, we have to build a genome annotation file using the BioMart at ensembl.org. Here’s how to do so:
- Go to the Ensembl BioMart at http://uswest.ensembl.org/biomart/martview/
- Choose the database to use, in this case “Ensembl Genes 99”.
- Choose an annotation to use, in this case “Human Genes (GRCh38.p13)”.
- On the lefthand sidebar, click “Attributes”, which will allow you to
select the items you want to map. For this analysis, you want:
- “Gene stable ID”, which is the Ensembl Id in our raw_counts.csv file (e.g. ENSG00000111640)
- “Gene name”, which is the most commonly used gene name (e.g. GAPDH)
- “Gene type”, which specifies which genes are protein-coding. If we want to perform Gene Set Enrichment Analysis (GSEA), we will need this category.
- You can un-check “Gene stable ID version”, “Transcript stable ID”, and “Transcript stable ID version”.
- Click on the results button, check “unique results only”, select “export as csv”, and hit the “Go” button!
The annotation should download to your computer as “mart_export.txt”. We can rename it to “GRCh38.p13_annotation.csv”, and read it into R:
annotation <- read.csv("GRCh38.p13_annotation.csv", header = T, stringsAsFactors = F)
head(annotation)
## Gene.stable.ID Gene.name Gene.type
## 1 ENSG00000210049 MT-TF Mt_tRNA
## 2 ENSG00000211459 MT-RNR1 Mt_rRNA
## 3 ENSG00000210077 MT-TV Mt_tRNA
## 4 ENSG00000210082 MT-RNR2 Mt_rRNA
## 5 ENSG00000209082 MT-TL1 Mt_tRNA
## 6 ENSG00000198888 MT-ND1 protein_coding
We observe that there are three columns corresponding to the annotations
that we selected. To map the gene names to another dataset, we can join
two tables based on the Ensembl IDs using a join function from the
tidyverse. For example, I can map the annotation to the normalized
counts table using right_join():
normalized_counts <- rownames_to_column(as.data.frame(normalized_counts), var = "ensembl_id")
annotated_data <- right_join(annotation, normalized_counts, by = c("Gene.stable.ID" = "ensembl_id"))
head(annotated_data)
## Gene.stable.ID Gene.name Gene.type LNCAP_Hypoxia_S1 LNCAP_Hypoxia_S2
## 1 ENSG00000210049 MT-TF Mt_tRNA 1.090749e+00 2.849938e+00
## 2 ENSG00000211459 MT-RNR1 Mt_rRNA 1.970219e+04 2.040840e+04
## 3 ENSG00000210077 MT-TV Mt_tRNA 0.000000e+00 0.000000e+00
## 4 ENSG00000210082 MT-RNR2 Mt_rRNA 1.560468e+05 1.578694e+05
## 5 ENSG00000209082 MT-TL1 Mt_tRNA 3.817620e+00 4.749896e+00
## 6 ENSG00000198888 MT-ND1 protein_coding 5.395278e+04 5.238375e+04
## LNCAP_Normoxia_S1 LNCAP_Normoxia_S2 PC3_Hypoxia_S1 PC3_Hypoxia_S2
## 1 2.422351e+01 11.90898 1.407243e+02 1.461438e+02
## 2 4.357020e+04 46733.82108 6.888532e+06 6.490617e+06
## 3 2.106392e+00 0.00000 1.791037e+02 1.461438e+02
## 4 5.286887e+05 443639.33738 1.979179e+07 1.883179e+07
## 5 1.685114e+01 25.09393 4.989318e+01 8.911207e+01
## 6 1.509241e+05 178563.27024 4.158532e+04 3.675695e+04
## PC3_Normoxia_S1 PC3_Normoxia_S2
## 1 5.797491e+01 1.594073e+02
## 2 6.654287e+06 7.287938e+06
## 3 2.410536e+02 3.881221e+02
## 4 1.456696e+07 1.793767e+07
## 5 5.187229e+01 1.189779e+02
## 6 6.430638e+04 8.450896e+04
write.csv(annotated_data, file = "gene_annotated_normalized_counts.csv")
Now, the gene names are now placed directly next to the Ensembl IDs. We can export this normalized counts file and provide it to collaborating scientists, who will be able to quickly search for their genes of interest! For examples of how to plot the normalized counts for a given gene across samples, see the section: Visualizations for DE results.
At this point, we can start to assess sample-to-sample variability. This
is important for determining whether you have outliers in your dataset,
as well as whether or not your data makes sense. For example, the gene
expression patterns of biological/technical replicates should look
fairly similar to one another. In this section, we will cover some
visualizations that can be used for this purpose. In order to use these
functions, we first perform a variance stabilizing transformation on the
data using vst():
vsd <- vst(dds, blind = TRUE)
The distance plot calculates the Euclidean distance between the expression values for each individual sample. This is a way to identify which samples are most closely related in terms of their gene expression patterns.
plotDists = function (vsd.obj) {
sampleDists <- dist(t(assay(vsd.obj)))
sampleDistMatrix <- as.matrix( sampleDists )
rownames(sampleDistMatrix) <- paste( vsd.obj$condition )
colors <- colorRampPalette( rev(RColorBrewer::brewer.pal(9, "Blues")) )(255)
pheatmap::pheatmap(sampleDistMatrix,
clustering_distance_rows = sampleDists,
clustering_distance_cols = sampleDists,
col = colors)
}
plotDists(vsd)
We observe that all the LNCaP samples cluster together and all the PC3 samples cluster together. Within each cell type, the hypoxia samples cluster together and the normoxia samples cluster together. These clustering patterns make sense, suggesting that the experiment was successful.
We can identify the genes that are driving the clustering between
samples and display them in a heatmap. To do so, we first obtain the top
most variable genes across samples by selecting the genes with the
highest rowVars() value. Then, we plug the normalized counts for these
genes into a heatmap using pheatmap::pheatmap(). The heatmap will
cluster the samples based on expression similarity as well as display
the genes that are associated with each cluster on the right-hand side.
Note that the genes are simply chosen based on variability across
samples. No statistical tests are performed to determine whether they
are actually significantly different between groups.
variable_gene_heatmap <- function (vsd.obj, num_genes = 500, annotation, title = "") {
brewer_palette <- "RdBu"
# Ramp the color in order to get the scale.
ramp <- colorRampPalette( RColorBrewer::brewer.pal(11, brewer_palette))
mr <- ramp(256)[256:1]
# get the stabilized counts from the vsd object
stabilized_counts <- assay(vsd.obj)
# calculate the variances by row(gene) to find out which genes are the most variable across the samples.
row_variances <- rowVars(stabilized_counts)
# get the top most variable genes
top_variable_genes <- stabilized_counts[order(row_variances, decreasing=T)[1:num_genes],]
# subtract out the means from each row, leaving the variances for each gene
top_variable_genes <- top_variable_genes - rowMeans(top_variable_genes, na.rm=T)
# replace the ensembl ids with the gene names
gene_names <- annotation$Gene.name[match(rownames(top_variable_genes), annotation$Gene.stable.ID)]
rownames(top_variable_genes) <- gene_names
# reconstruct colData without sizeFactors for heatmap labeling
coldata <- as.data.frame(vsd.obj@colData)
coldata$sizeFactor <- NULL
# draw heatmap using pheatmap
pheatmap::pheatmap(top_variable_genes, color = mr, annotation_col = coldata, fontsize_col = 8, fontsize_row = 250/num_genes, border_color = NA, main = title)
}
variable_gene_heatmap(vsd, num_genes = 40, annotation = annotation)
We see that the clustering is very similar to what we observed in the distance plot. There are a distinct set of genes that are specific to either LNCaP or PC3 cells. Given that we are analyzing data from cell lines, it is not surprising that the clustering is so clearly defined. If you are working with highly heterogenous samples (e.g. tissues), there may be significant variability across samples. Knowing the genes that are defining the differences between samples is useful for assessing whether there were sample preparation issues such as poor cell purity or tissue contamination.
A principal components plot is another way to observe how diverse the samples are. As always, the samples which are most similar with each other in terms of their gene expression values will be closer to each other on the plot. This plot uses a Cartesian coordinate system, and the axes that are displayed correspond to the top two principal components that explain the majority of the variability in the data.
plot_PCA = function (vsd.obj) {
pcaData <- plotPCA(vsd.obj, intgroup = c("condition"), returnData = T)
percentVar <- round(100 * attr(pcaData, "percentVar"))
ggplot(pcaData, aes(PC1, PC2, color=condition)) +
geom_point(size=3) +
labs(x = paste0("PC1: ",percentVar[1],"% variance"),
y = paste0("PC2: ",percentVar[2],"% variance"),
title = "PCA Plot colored by condition") +
ggrepel::geom_text_repel(aes(label = name), color = "black")
}
plot_PCA(vsd)
We observe that The LNCaP samples are furthest separated from the PC3 samples on the x-axis (PC1), which explains a whopping 99% of the variance in the dataset. Within each cell type, the normoxia samples are separated from the hypoxia samples. The amount of variability introduced by hypoxia is small compared to the inherent difference between the LNCaP and PC3 cell lines. If we are interested in the effects of hypoxia on gene expression, we should separate the LNCaP samples from the PC3 samples first, create separate DESeq2 objects, and then determine the effects of hypoxia on each cell line individually. I will cover how to do this in the next section.
Because a lot of the variability in the data is due to the difference in
the background of the cell lines, we must create separate DESeq2 objects
for the LNcaP and PC3 samples. The function generate_DESeq_object()
below will make a DESeq2 object using your raw counts data and the two
groups that you specify to compare. It will select the columns out from
the raw data that match the group designations using grep(), build the
colData matrix based on your group designations, and generate the
DESeq2 object using DESeqDataSetFromMatrix() and DESeq().
generate_DESeq_object <- function (my_data, groups) {
data_subset1 <- my_data[,grep(str_c("^", groups[1]), colnames(my_data))]
data_subset2 <- my_data[,grep(str_c("^", groups[2]), colnames(my_data))]
my_countData <- cbind(data_subset1, data_subset2)
condition <- c(rep(groups[1],ncol(data_subset1)), rep(groups[2],ncol(data_subset2)))
my_colData <- as.data.frame(condition)
rownames(my_colData) <- colnames(my_countData)
print(my_colData)
dds <- DESeqDataSetFromMatrix(countData = my_countData,
colData = my_colData,
design = ~ condition)
dds <- DESeq(dds, quiet = T)
return(dds)
}
The function should print the colData that was used to generate each
DESeq2 object, so we can double check to make sure that the appropriate
sample columns were selected and that the grouping was correct.
lncap <- generate_DESeq_object(data, c("LNCAP_Hypoxia", "LNCAP_Normoxia"))
## condition
## LNCAP_Hypoxia_S1 LNCAP_Hypoxia
## LNCAP_Hypoxia_S2 LNCAP_Hypoxia
## LNCAP_Normoxia_S1 LNCAP_Normoxia
## LNCAP_Normoxia_S2 LNCAP_Normoxia
pc3 <- generate_DESeq_object(data, c("PC3_Hypoxia", "PC3_Normoxia"))
## condition
## PC3_Hypoxia_S1 PC3_Hypoxia
## PC3_Hypoxia_S2 PC3_Hypoxia
## PC3_Normoxia_S1 PC3_Normoxia
## PC3_Normoxia_S2 PC3_Normoxia
Now that we have separated the LNCaP and PC3 samples, the
variable_gene_heatmap() should display genes that are enriched in
either the hypoxia vs normoxia conditions.
lncap_vsd <- vst(lncap, blind = T)
pc3_vsd <- vst(pc3, blind = T)
a <- variable_gene_heatmap(lncap_vsd, 30, annotation = annotation, title = "LNCaP variable genes")
b <- variable_gene_heatmap(pc3_vsd, 30, annotation = annotation, title = "PC3 variable genes")
gridExtra::grid.arrange(a[[4]],b[[4]], nrow = 1)
This is a vastly different set of genes than what was observed when we had samples from both cell lines combined. Our differential gene expression analysis should now yield a greater depth of genes for the comparison we care about: hypoxia vs normoxia.
Now that we have assessed sample-to-sample variability and gained confidence that our experiment was performed correctly, we are ready to start answering the most pressing question: what genes are differentially upregulated or downregulated by hypoxia in each cell line? In this section, I will explain how to generate differential expression gene lists from DESeq2 objects.
To extract the differentially expressed genes from the DESeq2 object, we
will use the results() function:
results(lncap, contrast = c("condition", "LNCAP_Hypoxia", "LNCAP_Normoxia"))
## log2 fold change (MLE): condition LNCAP_Hypoxia vs LNCAP_Normoxia
## Wald test p-value: condition LNCAP_Hypoxia vs LNCAP_Normoxia
## DataFrame with 60676 rows and 6 columns
## baseMean log2FoldChange lfcSE stat pvalue
## ENSG00000000003 520.186779 0.89074143 0.1775024 5.0181939 5.215951e-07
## ENSG00000000005 0.000000 NA NA NA NA
## ENSG00000000419 4974.737407 -0.08275249 0.1079697 -0.7664419 4.434134e-01
## ENSG00000000457 710.803637 0.47417029 0.1580068 3.0009481 2.691405e-03
## ENSG00000000460 492.462672 -0.12784678 0.1970602 -0.6487700 5.164870e-01
## ENSG00000000938 1.786214 0.50050523 2.3050236 0.2171367 8.281018e-01
## padj
## ENSG00000000003 6.202081e-06
## ENSG00000000005 NA
## ENSG00000000419 6.202886e-01
## ENSG00000000457 1.154137e-02
## ENSG00000000460 6.853607e-01
## ENSG00000000938 NA
We observe that the hypoxia condition was compared to the normoxia
condition, and that there are columns corresponding to statistics
calculated for each gene. The columns that you should pay the most
attention to are baseMean, log2FoldChange, and padj.
- The
baseMeanis a measure of the overall expression of the gene. We can assess whether is it a highly-expressed gene or if it is only barely above baseline. - The
log2FoldChangemeasures how much higher the gene is in the hypoxia condition compared to the normoxia condition. Negative values mean the expression is higher in the normoxia group. - The
padjcolumn is a measure of how likely the gene is to be significantly different between the two conditions being compared.
We will use these metrics to filter, organize, and export lists of differentially expressed genes. I chose to use the following criteria:
- Select genes that are signifcantly different based on
padj, in which thepadjis lower than a specified cutoff value. - Sort by
log2FoldChangeto identify the genes that are most highly up or down. - (optional) Filter out genes that are very lowly-expressed (low
baseMeanvalues) which are not as likely to be biologically relevant. To do so, we can either usebaseMeanor we can calculate another metric called “counts per million” (cpm). The counts per million value is more intuitive because we can use a similar cutoff value across different sequencing experiments. - Generate a ranked gene list file (
.rnk), which is a list of all the genes in the dataset ordered bylog2FoldChange. This file is required for Gene Set Enrichment Analysis, which I will explain later in the GSEA section.
Since there are many variations of sorting / filtering the data, I wrote
the function generate_DE_results() to perform multiple filtering steps
and provide output in the form of csv files. I export these files so
they can be easily shared and interpreted by other bench scientists
without having to read the data into R.
generate_DE_results <- function (dds, comparisons, padjcutoff = 0.001, log2cutoff = 0.5, cpmcutoff = 2) {
# generate average counts per million metric from raw count data
raw_counts <- counts(dds, normalized = F)
cpms <- enframe(rowMeans(edgeR::cpm(raw_counts)))
colnames(cpms) <- c("ensembl_id", "avg_cpm")
# extract DESeq results between the comparisons indicated
res <- results(dds, contrast = c("condition", comparisons[1], comparisons[2]))[,-c(3,4)]
# annotate the data with gene name and average counts per million value
res <- as_tibble(res, rownames = "ensembl_id")
# read in the annotation and append it to the data
my_annotation <- read.csv("GRCh38.p13_annotation.csv", header = T, stringsAsFactors = F)
res <- left_join(res, my_annotation, by = c("ensembl_id" = "Gene.stable.ID"))
# append the average cpm value to the results data
res <- left_join(res, cpms, by = c("ensembl_id" = "ensembl_id"))
# combine normalized counts with entire DE list
normalized_counts <- round(counts(dds, normalized = TRUE),3)
pattern <- str_c(comparisons[1], "|", comparisons[2])
combined_data <- as_tibble(cbind(res, normalized_counts[,grep(pattern, colnames(normalized_counts))] ))
combined_data <- combined_data[order(combined_data$log2FoldChange, decreasing = T),]
# make ordered rank file for GSEA, selecting only protein coding genes
res_prot <- res[which(res$Gene.type == "protein_coding"),]
res_prot_ranked <- res_prot[order(res_prot$log2FoldChange, decreasing = T),c("Gene.name", "log2FoldChange")]
res_prot_ranked <- na.omit(res_prot_ranked)
res_prot_ranked$Gene.name <- str_to_upper(res_prot_ranked$Gene.name)
# generate sorted lists with the indicated cutoff values
res <- res[order(res$log2FoldChange, decreasing=TRUE ),]
de_genes_padj <- res[which(res$padj < padjcutoff),]
de_genes_log2f <- res[which(abs(res$log2FoldChange) > log2cutoff & res$padj < padjcutoff),]
de_genes_cpm <- res[which(res$avg_cpm > cpmcutoff & res$padj < padjcutoff),]
# write output to files
write.csv (de_genes_padj, file = paste0(comparisons[1], "_vs_", comparisons[2], "_padj_cutoff.csv"), row.names =F)
write.csv (de_genes_log2f, file = paste0(comparisons[1], "_vs_", comparisons[2], "_log2f_cutoff.csv"), row.names =F)
write.csv (de_genes_cpm, file = paste0(comparisons[1], "_vs_", comparisons[2], "_cpm_cutoff.csv"), row.names =F)
write.csv (combined_data, file = paste0(comparisons[1], "_vs_", comparisons[2], "_allgenes.csv"), row.names =F)
write.table (res_prot_ranked, file = paste0(comparisons[1], "_vs_", comparisons[2], "_rank.rnk"), sep = "\t", row.names = F, quote = F)
writeLines( paste0("For the comparison: ", comparisons[1], "_vs_", comparisons[2], ", out of ", nrow(combined_data), " genes, there were: \n",
nrow(de_genes_padj), " genes below padj ", padjcutoff, "\n",
nrow(de_genes_log2f), " genes below padj ", padjcutoff, " and above a log2FoldChange of ", log2cutoff, "\n",
nrow(de_genes_cpm), " genes below padj ", padjcutoff, " and above an avg cpm of ", cpmcutoff, "\n",
"Gene lists ordered by log2fchange with the cutoffs above have been generated.") )
gene_count <- tibble (cutoff_parameter = c("padj", "log2fc", "avg_cpm" ),
cutoff_value = c(padjcutoff, log2cutoff, cpmcutoff),
signif_genes = c(nrow(de_genes_padj), nrow(de_genes_log2f), nrow(de_genes_cpm)))
invisible(gene_count)
}
After running the function, the console should display the number of genes that passed each filtering critera:
lncap_output <- generate_DE_results (lncap, c("LNCAP_Hypoxia", "LNCAP_Normoxia"))
## For the comparison: LNCAP_Hypoxia_vs_LNCAP_Normoxia, out of 60676 genes, there were:
## 2897 genes below padj 0.001
## 2654 genes below padj 0.001 and above a log2FoldChange of 0.5
## 2729 genes below padj 0.001 and above an avg cpm of 2
## Gene lists ordered by log2fchange with the cutoffs above have been generated.
pc3_output <- generate_DE_results(pc3, c("PC3_Hypoxia", "PC3_Normoxia"))
## For the comparison: PC3_Hypoxia_vs_PC3_Normoxia, out of 60676 genes, there were:
## 1606 genes below padj 0.001
## 1362 genes below padj 0.001 and above a log2FoldChange of 0.5
## 1552 genes below padj 0.001 and above an avg cpm of 2
## Gene lists ordered by log2fchange with the cutoffs above have been generated.
We should also see a set of csv files show up in the same folder as the
R script. We can read in the output files with read.csv() and observe
what the file structure is like:
res <- read.csv("LNCAP_Hypoxia_vs_LNCAP_Normoxia_allgenes.csv", header = T)
head(res)
## ensembl_id baseMean log2FoldChange pvalue padj Gene.name
## 1 ENSG00000283339 39.80668 8.825414 7.430094e-09 1.237992e-07 AC093726.3
## 2 ENSG00000203664 35.44453 8.655707 1.916346e-08 2.933740e-07 OR2W5
## 3 ENSG00000261051 21.18835 7.915735 6.892832e-07 7.985314e-06 AC107021.2
## 4 ENSG00000171954 20.04605 7.834644 1.015440e-06 1.131000e-05 CYP4F22
## 5 ENSG00000276107 16.69813 7.575064 4.423505e-06 4.248312e-05 AC037198.1
## 6 ENSG00000204136 81.25640 7.409162 7.029614e-12 1.760071e-10 GGTA1P
## Gene.type avg_cpm LNCAP_Hypoxia_S1
## 1 unprocessed_pseudogene 0.9578540 75.727
## 2 transcribed_unprocessed_pseudogene 0.8520883 83.523
## 3 lncRNA 0.5098586 40.091
## 4 protein_coding 0.4821528 42.318
## 5 lncRNA 0.4023290 21.159
## 6 transcribed_unitary_pseudogene 1.9541496 172.613
## LNCAP_Hypoxia_S2 LNCAP_Normoxia_S1 LNCAP_Normoxia_S2
## 1 83.500 0.000 0.000
## 2 58.255 0.000 0.000
## 3 44.663 0.000 0.000
## 4 37.866 0.000 0.000
## 5 45.633 0.000 0.000
## 6 150.493 1.057 0.862
The _allgenes.csv file will be used in the next section for
visualizations. It is an aggregate of all the data we have curated so
far: the results() output, the gene annotations, and the normalized
counts for every gene. We can further organize/filter the data for the
visualizations based on user preferences. The other csv files, such as
_padj_cutoff.csv, can be distributed to researchers who are only
interested in the gene lists.
Now that we have extracted the results from our DESeq2 object, we can start visualizing the differentially expressed genes. In this section, I will showcase some plotting functions that I wrote to answer questions such as:
- How is a given gene of interest expressed across groups?
- What is the sample-to-sample variability for the top differentially expressed genes?
- Are there more upregulated or downregulated genes?
- If we are performing multiple comparisons, which differentially expressed genes are shared?
- What gene pathways are enriched in one group vs another?
We are often interested in plotting the normalized counts for certain
genes of interest, in order to get a sense of the spread of the data and
how genes are expressed across each of the groups. This is especially of
interest for genes that show up as differentially expressed in our
DESeq2 results. A way to plot the normalized counts for each sample is
by using the built-in DESeq2::plotCounts() function. However, this
function leaves a lot to be desired. As an example, I plot the gene
IGFBP1 (a hypoxia-inducible gene) using its Ensembl ID below.
plotCounts(dds, gene="ENSG00000146678", intgroup="condition")
As you can see, the sample names aren’t even all displayed if their
names are too long. We can instead use ggplot2 to graph the data, by
extracting the normalized counts using returnData = TRUE:
d <- plotCounts(dds, gene="ENSG00000146678", intgroup="condition", returnData=TRUE)
d
## count condition
## LNCAP_Hypoxia_S1 0.500000 LNCAP_Hypoxia
## LNCAP_Hypoxia_S2 1.924969 LNCAP_Hypoxia
## LNCAP_Normoxia_S1 0.500000 LNCAP_Normoxia
## LNCAP_Normoxia_S2 0.500000 LNCAP_Normoxia
## PC3_Hypoxia_S1 29.924182 PC3_Hypoxia
## PC3_Hypoxia_S2 25.451380 PC3_Hypoxia
## PC3_Normoxia_S1 0.500000 PC3_Normoxia
## PC3_Normoxia_S2 5.120501 PC3_Normoxia
ggplot(d, aes(x=condition, y=count)) +
geom_point(position=position_jitter(w=0.1,h=0), aes (color = condition)) +
scale_y_log10(breaks=c(25,100,400))
However, this is still very frustrating to work with, since we have to
input the Ensembl ID instead of a gene name. Researchers typically want
to search by gene name, and this function forces us to look up the
Ensembl ID each time. To solve this problem, I wrote my own function
plot_counts() to accept either the gene name, Ensembl ID, or an index
such as which.min(res$padj). I also provide two ways to normalize the
data: by counts per million (cpm) or using the built-in DESeq2
normalized counts.
plot_counts <- function (dds, gene, normalization = "DESeq2"){
# read in the annotation file
annotation <- read.csv("GRCh38.p13_annotation.csv", header = T, stringsAsFactors = F)
# obtain normalized data
if (normalization == "cpm") {
normalized_data <- cpm(counts(dds, normalized = F)) # normalize the raw data by counts per million
} else if (normalization == "DESeq2")
normalized_data <- counts(dds, normalized = T) # use DESeq2 normalized counts
# get sample groups from colData
condition <- dds@colData$condition
# get the gene name from the ensembl id
if (is.numeric(gene)) { # check if an index is supplied or if ensembl_id is supplied
if (gene%%1==0 )
ensembl_id <- rownames(normalized_data)[gene]
else
stop("Invalid index supplied.")
} else if (gene %in% annotation$Gene.name){ # check if a gene name is supplied
ensembl_id <- annotation$Gene.stable.ID[which(annotation$Gene.name == gene)]
} else if (gene %in% annotation$Gene.stable.ID){
ensembl_id <- gene
} else {
stop("Gene not found. Check spelling.")
}
expression <- normalized_data[ensembl_id,]
gene_name <- annotation$Gene.name[which(annotation$Gene.stable.ID == ensembl_id)]
# construct a tibble with the grouping and expression
gene_tib <- tibble(condition = condition, expression = expression)
ggplot(gene_tib, aes(x = condition, y = expression))+
geom_boxplot(outlier.size = NULL)+
geom_point()+
labs (title = paste0("Expression of ", gene_name, " - ", ensembl_id), x = "group", y = paste0("Normalized expression (", normalization , ")"))+
theme(axis.text.x = element_text(size = 11), axis.text.y = element_text(size = 11))
}
plot_counts(dds, "IGFBP1")
We observe that IGFBP1 is elevated in the the hypoxia conditions relative to the respective normoxia controls. Interestingly, the upregulation of IGFBP1 is much higher in PC3 cells than in LNCaP cells. This is a nice example of how this plot is useful to determine relative expression levels between samples.
The most common heatmap used to display RNA-seq results is the
differential gene heatmap. This is a heatmap where the normalized values
for each sample are plotted for the top most upregulated genes which are
significantly different between the comparison groups. Starting from the
results object, we first filter the results by padj and then take the
genes which have the greatest log2FoldChange value. The normalized
counts for each gene is scaled by row (across samples) in order to
emphasize the difference between the comparison groups (hypoxia vs
normoxia). The purpose of this visualization is to give a sense of how
variable the data are from sample to sample, as well as to quickly
examine the top differential genes. I wrote the function
DE_gene_heatmap() to generate this plot, using pheatmap::pheatmap()
with the scale = "row" argument.
res <- read.csv ("LNCAP_Hypoxia_vs_LNCAP_Normoxia_allgenes.csv", header = T)
DE_gene_heatmap <- function(res, padj_cutoff = 0.0001, ngenes = 20) {
# generate the color palette
brewer_palette <- "RdBu"
ramp <- colorRampPalette(RColorBrewer::brewer.pal(11, brewer_palette))
mr <- ramp(256)[256:1]
# obtain the significant genes and order by log2FoldChange
significant_genes <- res %>% filter(padj < padj_cutoff) %>% arrange (desc(log2FoldChange)) %>% head (ngenes)
heatmap_values <- as.matrix(significant_genes[,-c(1:8)])
rownames(heatmap_values) <- significant_genes$Gene.name
# plot the heatmap using pheatmap
pheatmap::pheatmap(heatmap_values, color = mr, scale = "row", fontsize_col = 10, fontsize_row = 200/ngenes, fontsize = 5, border_color = NA)
}
DE_gene_heatmap(res, 0.001, 30)
We observe that expression of the differential genes is very consistent within groups. We are also able to identify that LNCAP_Hypoxia_S1 has higher expression of the top ~10 genes than LNCAP_Hypoxia_S2.
Another common visualization for bulk RNA-seq is the volcano plot, which
is a scatterplot that displays the log2FoldChange value vs the
-log(padj) value for each gene in the comparison. We can use this plot
to quickly identify genes that are highly upregulated or downregulated,
or identify genes that have highly significant p-values. Below is an
example volcano plot showing the most significant genes in the hypoxia
vs normoxia comparison for LNCaP cells.
res <- read.csv ("LNCAP_Hypoxia_vs_LNCAP_Normoxia_allgenes.csv", header = T)
plot_volcano <- function (res, padj_cutoff, nlabel = 10, label.by = "padj"){
# assign significance to results based on padj
res <- mutate(res, significance=ifelse(res$padj<padj_cutoff, paste0("padj < ", padj_cutoff), paste0("padj > ", padj_cutoff)))
res = res[!is.na(res$significance),]
significant_genes <- res %>% filter(significance == paste0("padj < ", padj_cutoff))
# get labels for the highest or lowest genes according to either padj or log2FoldChange
if (label.by == "padj") {
top_genes <- significant_genes %>% arrange(padj) %>% head(nlabel)
bottom_genes <- significant_genes %>% filter (log2FoldChange < 0) %>% arrange(padj) %>% head (nlabel)
} else if (label.by == "log2FoldChange") {
top_genes <- head(arrange(significant_genes, desc(log2FoldChange)),nlabel)
bottom_genes <- head(arrange(significant_genes, log2FoldChange),nlabel)
} else
stop ("Invalid label.by argument. Choose either padj or log2FoldChange.")
ggplot(res, aes(log2FoldChange, -log(padj))) +
geom_point(aes(col=significance)) +
scale_color_manual(values=c("red", "black")) +
ggrepel::geom_text_repel(data=top_genes, aes(label=head(Gene.name,nlabel)), size = 3)+
ggrepel::geom_text_repel(data=bottom_genes, aes(label=head(Gene.name,nlabel)), color = "#619CFF", size = 3)+
labs ( x = "Log2FoldChange", y = "-(Log normalized p-value)")+
geom_vline(xintercept = 0, linetype = "dotted")+
theme_minimal()
}
plot_volcano(res, 0.0005, nlabel = 15, label.by = "padj")
The downregulated genes are labeled in a different color compared to the upregulated genes. We observe that there are a lot more significantly upregulated genes than there are downregulated genes. Given that we are looking for gene expression changes in cells grown in hypoxic conditions compared to normoxic conditions, this suggests that cells may be ramping up transcription of response pathways.
Given that we have performed differential gene expression analysis on two different cell lines, we would like to compare the two lines in terms of how their gene expression responds to hypoxia. We want to answer questions such as:
- Are the genes that are induced by hypoxia similar in both cell lines?
- Which significant genes are shared by both cell lines and which genes are unique to each cell line?
To do so, we can take the significant genes from the hypoxia vs normoxia
comparison for both lines and generate a scatterplot of their
log2FoldChange values using the custom function below,
compare_significant_genes(). This function will display the overlap in
the gene lists by color coding significant genes that are shared by both
cell lines, as well as those that are unique to each individual cell
line.
res1 <- read.csv ("LNCAP_Hypoxia_vs_LNCAP_Normoxia_allgenes.csv", header = T)
res2 <- read.csv ("PC3_Hypoxia_vs_PC3_Normoxia_allgenes.csv", header = T)
compare_significant_genes <- function (res1, res2, padj_cutoff=0.0001, ngenes=250, nlabel=10, samplenames=c("comparison1", "comparison2"), title = "" ) {
# get list of most upregulated or downregulated genes for each results table
genes1 <- rbind(head(res1[which(res1$padj < padj_cutoff),], ngenes), tail(res1[which(res1$padj < padj_cutoff),], ngenes))
genes2 <- rbind(head(res2[which(res2$padj < padj_cutoff),], ngenes), tail(res2[which(res2$padj < padj_cutoff),], ngenes))
# combine the data from both tables
de_union <- union(genes1$ensembl_id,genes2$ensembl_id)
res1_union <- res1[match(de_union, res1$ensembl_id),][c("ensembl_id", "log2FoldChange", "Gene.name")]
res2_union <- res2[match(de_union, res2$ensembl_id),][c("ensembl_id", "log2FoldChange", "Gene.name")]
combined <- left_join(res1_union, res2_union, by = "ensembl_id", suffix = samplenames )
# identify overlap between genes in both tables
combined$de_condition <- 1 # makes a placeholder column
combined$de_condition[which(combined$ensembl_id %in% intersect(genes1$ensembl_id,genes2$ensembl_id))] <- "Significant in Both"
combined$de_condition[which(combined$ensembl_id %in% setdiff(genes1$ensembl_id,genes2$ensembl_id))] <- paste0("Significant in ", samplenames[1])
combined$de_condition[which(combined$ensembl_id %in% setdiff(genes2$ensembl_id,genes1$ensembl_id))] <- paste0("Significant in ", samplenames[2])
combined[is.na(combined)] <- 0
# find the top most genes within each condition to label on the graph
label1 <- rbind(head(combined[which(combined$de_condition==paste0("Significant in ", samplenames[1])),],nlabel),
tail(combined[which(combined$de_condition==paste0("Significant in ", samplenames[1])),],nlabel))
label2 <- rbind(head(combined[which(combined$de_condition==paste0("Significant in ", samplenames[2])),],nlabel),
tail(combined[which(combined$de_condition==paste0("Significant in ", samplenames[2])),],nlabel))
label3 <- rbind(head(combined[which(combined$de_condition=="Significant in Both"),],nlabel),
tail(combined[which(combined$de_condition=="Significant in Both"),],nlabel))
combined_labels <- rbind(label1,label2,label3)
# plot the genes based on log2FoldChange, color coded by significance
ggplot(combined, aes_string(x = paste0("log2FoldChange", samplenames[1]), y = paste0("log2FoldChange", samplenames[2]) )) +
geom_point(aes(color = de_condition), size = 0.7)+
scale_color_manual(values= c("#00BA38", "#619CFF", "#F8766D"))+
ggrepel::geom_text_repel(data= combined_labels, aes_string(label=paste0("Gene.name", samplenames[1]), color = "de_condition"), show.legend = F, size=3)+
geom_vline(xintercept = c(0,0), size = 0.3, linetype = 2)+
geom_hline(yintercept = c(0,0), size = 0.3, linetype = 2)+
labs(title = title,x = paste0("log2FoldChange in ", samplenames[1]), y = paste0("log2FoldChange in ", samplenames[2]))+
theme_minimal()+
theme(legend.title = element_blank())
}
compare_significant_genes(res1,res2, samplenames = c("LNCaP", "PC3"), title = "Hypoxia-induced gene expression differences in LNCaP vs PC3 cells")
We observe that there are indeed a small subset of genes that are differentially expressed in both the LNCaP as well as PC3 comparisons (green labels). It is satisfying to see that the majority of these shared genes fall along the x = y diagonal. For example, genes such as CA9, IGFBP5, STC1, and PPFIA4 are greatly induced by hypoxia in both lines. These genes are more likely to be real indicators of the hypoxia response. In contrast, the genes that are significant in only one cell line mostly lie on the vertical or horizontal axis. These genes are likely associated with responses specific to the background of each cell line, and are unlikely to be universal indicators of hypoxia.
Gene Set Enrichment Analysis (GSEA) can be used to test whether pathways consisting of multiple genes are enriched in one group compared to another. For example, there is a “gene set” of 200 genes that composes the hypoxia pathway. We would like to determine whether the genes associated with the hypoxia pathway are collectively upregulated in the hypoxia condition, as a way to verify that the experiment was performed correctly. We also want to determine which other pathways hypoxia is affecting inside the cell.
To perform GSEA, we have to rank every gene available in terms of how
much higher or lower it is in group A vs group B. This is called a
ranked list, and we have already generated one in the above section
using the function generate_DE_results(). We can plug this ranked list
into either the GSEA application from the Broad Institute
(https://www.gsea-msigdb.org/gsea/index.jsp),
or into the R package fgsea from Bioconductor
(https://bioconductor.org/packages/release/bioc/html/fgsea.html).
If you choose to use the GSEA application rather than the R package, the
ranked lists have to be in a very specific format. The genes must be all
upper-case, and file should contain one column for the gene name and
another column with the corresponding logfoldchange. Here, we will be
using the R package fgsea to perform GSEA.
The R package fgsea can be installed from Bioconductor using the
commands:
if (!requireNamespace("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("fgsea")
We also need to download the pathway files from the GSEA MSigDB webpage
at:
https://www.gsea-msigdb.org/gsea/msigdb/collections.jsp
and load them in using fgsea::gmtPathways(). I will be working with
the HALLMARK pathway set.
library(fgsea)
# read in file containing lists of genes for each pathway
hallmark_pathway <- gmtPathways("h.all.v7.0.symbols.gmt.txt")
head(names(hallmark_pathway))
## [1] "HALLMARK_TNFA_SIGNALING_VIA_NFKB" "HALLMARK_HYPOXIA"
## [3] "HALLMARK_CHOLESTEROL_HOMEOSTASIS" "HALLMARK_MITOTIC_SPINDLE"
## [5] "HALLMARK_WNT_BETA_CATENIN_SIGNALING" "HALLMARK_TGF_BETA_SIGNALING"
The pathway file is loaded as a list of gene sets. We can access the
genes for each pathway by selecting the pathway name using $:
head(hallmark_pathway$HALLMARK_HYPOXIA, 20)
## [1] "PGK1" "PDK1" "GBE1" "PFKL" "ALDOA" "ENO2" "PGM1"
## [8] "NDRG1" "HK2" "ALDOC" "GPI" "MXI1" "SLC2A1" "P4HA1"
## [15] "ADM" "P4HA2" "ENO1" "PFKP" "AK4" "FAM162A"
After loading the pathways, we have to turn our ranked list into a
vector, in which the log2FoldChange value is named with the gene name.
We also need to get rid of any NA values or duplicate gene entries. The
custom function prepare_ranked_list() will perform these operations.
# load the ranked list
lncap_ranked_list <- read.table("LNCAP_Hypoxia_vs_LNCAP_Normoxia_rank.rnk", header = T, stringsAsFactors = F)
head(lncap_ranked_list)
## Gene.name log2FoldChange
## 1 CYP4F22 7.834644
## 2 TGFB1 7.380095
## 3 BEND5 7.223460
## 4 RXFP1 6.700811
## 5 KRT72 6.574523
## 6 LRAT 6.440758
# formats the ranked list for the fgsea() function
prepare_ranked_list <- function(ranked_list) {
# if duplicate gene names present, average the values
if( sum(duplicated(ranked_list$Gene.name)) > 0) {
ranked_list <- aggregate(.~Gene.name, FUN = mean, data = ranked_list)
ranked_list <- ranked_list[order(ranked_list$log2FoldChange, decreasing = T),]
}
# omit rows with NA values
ranked_list <- na.omit(ranked_list)
# turn the dataframe into a named vector
ranked_list <- tibble::deframe(ranked_list)
ranked_list
}
lncap_ranked_list <- prepare_ranked_list(lncap_ranked_list)
head(lncap_ranked_list)
## CYP4F22 TGFB1 BEND5 RXFP1 KRT72 LRAT
## 7.834644 7.380095 7.223460 6.700811 6.574523 6.440758
Now that we have the named vector, we can plug it into the fgsea()
function along with the hallmark pathways object. This will generate a
table of results containing the enrichment scores associated with each
pathway.
# generate GSEA results table using fgsea() by inputting the pathway list and ranked list
fgsea_results <- fgsea(pathways = hallmark_pathway,
stats = lncap_ranked_list,
minSize = 15,
maxSize = 500,
nperm= 1000)
fgsea_results %>% arrange (desc(NES)) %>% select (pathway, padj, NES) %>% head()
## pathway padj NES
## 1: HALLMARK_HYPOXIA 0.009763718 2.162278
## 2: HALLMARK_ANDROGEN_RESPONSE 0.009763718 1.926858
## 3: HALLMARK_ANGIOGENESIS 0.009763718 1.892798
## 4: HALLMARK_GLYCOLYSIS 0.009763718 1.855142
## 5: HALLMARK_TGF_BETA_SIGNALING 0.009763718 1.840207
## 6: HALLMARK_UV_RESPONSE_DN 0.009763718 1.756341
The normalized enrichment scores (NES) tell us how much more enriched the pathway is in the hypoxia samples compared to the normoxia samples. As expected, we observe that the most enriched pathway in response to hypoxia is the HALLMARK_HYPOXIA pathway.
We can visualize the statistics for each pathway using a “waterfall” plot, which is a sideways bar plot of normalized enrichment scores for each of the pathways, color-coded by significance. This plot is great for quickly identifying the significantly enriched pathways.
waterfall_plot <- function (fsgea_results, graph_title) {
fgsea_results %>%
mutate(short_name = str_split_fixed(pathway, "_",2)[,2])%>% # removes 'HALLMARK_' from the pathway title
ggplot( aes(reorder(short_name,NES), NES)) +
geom_bar(stat= "identity", aes(fill = padj<0.05))+
coord_flip()+
labs(x = "Hallmark Pathway", y = "Normalized Enrichment Score", title = graph_title)+
theme(axis.text.y = element_text(size = 7),
plot.title = element_text(hjust = 1))
}
waterfall_plot(fgsea_results, "Hallmark pathways altered by hypoxia in LNCaP cells")
In addition to the hypoxia pathway, the androgen response and MTORC1 signaling pathways also appear to be significantly enriched in hypoxic conditions. Some interesting metabolic changes are also occuring. Similar to the Warburg effect, we observe that the glycolysis pathway is greatly enriched in the hypoxia condition, and that oxidative phosphorylation is negatively enriched. Since tumors become progressively hypoxic during cancer progression, this data may suggest that the hypoxic conditions are a driver of the metabolic switch from oxidative phosphorylation to glycolysis as an energy source.
Interestingly, the interferon response pathways are both negatively enriched in hypoxic conditions, suggesting that hypoxic cells may be less able to respond to interferons. Given that the cells were cultured in vitro (an environment where interferons are probably not present), I find this result unexpected.
We can also narrow in on specific pathways of interest by plotting
“enrichment curves” using the function fgsea::plotEnrichment(). In
these plots, the black ticks on the x-axis indicate a gene in the
pathway, and the green curve is a measure of how enriched the genes are
for either the hypoxia group (left side) or the normoxia group (right
side). Example curves for pathways highly enriched in either hypoxia or
normoxia are shown below.
# wrapper for fgsea::plotEnrichment()
plot_enrichment <- function (geneset, pathway, ranked_list) {
plotEnrichment(geneset[[pathway]], ranked_list)+labs (title = pathway)
}
# example of positively enriched pathway (up in Hypoxia)
plot_enrichment(hallmark_pathway, "HALLMARK_GLYCOLYSIS" , lncap_ranked_list)
# example of negatively enriched pathway (down in Hypoxia)
plot_enrichment(hallmark_pathway, "HALLMARK_OXIDATIVE_PHOSPHORYLATION" , lncap_ranked_list)
These types of enrichment curves are commonly shown in scientific publications to emphasize upregulation / downregulation of specific pathways of interest.
Here, I have shown you a complete bulk RNA-sequencing analysis pipeline, starting from downloading and processing the raw sequencing files all the way to creating visualizations for differentially expressed genes and pathways. From our analysis, we have observed that:
- LNCaP cells and PC3 cells differ vastly in their global gene expression profiles.
- Both cell lines upregulate a shared set of genes under hypoxic conditions.
- Hypoxia upregulates genes associated with glycolysis and downregulates genes associated with oxidative phosphorylation, suggesting that a metabolic switch is occuring.
We have generated differential expression gene lists for each cell line, which can be explored for novel genes associated with the hypoxia response. Furthermore, we have learned how to produce several different types of visualizations that can be used to display and explore bulk RNA-sequencing data.
I hope my analysis pipepline has helped you make sense of your bulk RNA-sequencing data. If you are also interested in learning about single-cell RNA-sequencing data analysis, I have a comprehensive guide written at https://erilu.github.io/single-cell-rnaseq-analysis/. Thanks for reading!












