Test repo for ngs 2016 students to test making changes, pull requests, and submitting issues.
Getting started with sharing files on Github tutorial: http://angus.readthedocs.io/en/2016/LC-github.html
You do you
1.01_StringBasics.ipynb file from Ben Langmead: http://www.langmead-lab.org/teaching-materials/
Original file: https://github.com/BenLangmead/ads1-notebooks/blob/master/1.01_StringBasics.ipynb
Jupyter notebook lesson: http://angus.readthedocs.io/en/2016/jupyter_notebook.html
Github lesson: http://angus.readthedocs.io/en/2016/LC-github.html
Articles on open science and reproducibility:
- McKiernan et al. 2016. How open science helps researchers. eLife. https://elifesciences.org/content/5/e16800
- Teal and Shade. 2015. Computing Workflows for Biologists. http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.1002303
- Bik and Goldstein. 2013. An Introduction to Social Media for Scientists http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.1001535
- https://en.wikipedia.org/wiki/Open_science
- https://gigascience.biomedcentral.com/articles/10.1186/s13742-015-0071-8
- http://www.nature.com/news/could-students-solve-the-irreproducibility-crisis-1.18095
To Do:
- add .ipynb files
- add cool links to README.md
- add documentation and argparse command-line arguments to merge_counts.py for merging salmon quant.sf TPM counts
- explain purpose of repo
- other items
- you do you
Cool links:
- Alignment is hard, test yourself against a computer: http://phylo.cs.mcgill.ca/
- Python visualizations can be cool: http://scikit-learn.org/stable/auto_examples/index.html
- More Python visualizations! https://stanford.edu/~mwaskom/software/seaborn/
This is how to check the length of a sequence, but I can never remember it:
a=TGCGGTTATCCATCTGCTTATGGAAGCCAAGCATTGGGGATTGAGAAAGAGTAGAAATGCCA
echo ${#a}
This is a change. #I'm doing things to this file
Will this get me a sticker?