Folders and files
| Name | Name | Last commit date | ||
|---|---|---|---|---|
Repository files navigation
The directory T1-RNA-kinetic-simulation-scripts contain the kinetic simulation scripts for T1 RNA. The directories T1-short, T1, T1-delAU, T1-add2bp, T2, T3, and T4 contain the filtering and the analytical scripts to obtain our desired RNA candidates (The Linux executable version of MC-Fold can be downloaded from https://www.major.iric.ca/MC-Fold/). The directory MCFOLD-DB is required when executing mcfold.static.exe. Here are the candidate sequences we have selected for each RNA: T1-short: seq267: GGGAAGGGCAACUUUCA (T1-short) seq608: GGGCCUUGCAAAGGGUA (The full candidate list: T1-short/run_mcfold/set_all_Mcfold_2D_result_G_less_than_3/select_the_sample/step12_new_sort.out) T1: seq77:GGCGCGUACGGAAGGGCAACUUUCAUACCGCGCC seq171:GGCGCGCCUGGAAGGGCAACUUUCACUUCGCGCC seq1:GGCGCGAAAGGAAGGGCAACUUUCAAAACGCGCC (T1) (The full candidate list: T1/run_mcfold/step_new_43_sort.out) T1-delAU: seq3:GGGAGGGCAACUUCA (T1-delAU) (The full candidate list: T1-delAU/run_mcfold/step_new_43_sort.out) T1-add2bp: seq24:GGGGGAAGGGCAACUUUUCUA (T1-add2bp) (The full candidate list: T1-add2bp/run_mcfold/step_new_43_sort.out) T2: seq89:GUUCCUGCAAAGGGAA (T2) (The full candidate list: T2/run_mcfold/step_new_43_sort.out) T3: seq232: GGAGGUGGCAACGUCUA seq297: GGGCAUGGCAAUGUGCA seq320: GGGGAUGGCAAUGUCCA seq256: GGGUAUGGCAAUGUACA (T3) (The full candidate list: T3/run_mcfold/step_new_43_sort.out) T4: seq4:GGGAAGUGCGCGCUUCGGCGCGCCUUUCC (T4) (The full candidate list: T4/run_mcfold/step_new_43_sort.out)