- CMDTarget (Comparative Modeling based Denosing for sRNA Target prediction) is a computational tool for sRNA target prediction and evolutionary analysis.
- While conceptually similar to CopraRNA, CMDTarget has several distinct features:
- CMDTarget explicitly leverage information of evolutionary conservation, while unlike CopraRNA, it does not force homolog sRNA-mRNA pairs across different species to have the same interaction score by explicitly reconstruct interaction scores of both extant and ancestral sRNA-mRNA pairs.
- CMDTarget includes a module for Hfq binding prediction, and could optionally incorporate predicted Hfq binding scores for sRNA target prediction.
- If you have multiple sRNAs, or a large genome set for comparative analysis, comparative genomics based sRNA target prediction can be computationally intensive. CMDTarget was built with snakemake, CMDTarget is friendly for HPC environments.
- We recommand using conda to automatically resolve for dependency
conda env create -f environment.yml
#alternatively, the following command should work
#conda install python snakemake ete3 intarna mafft cd-hit FastTree mmseqs2 hmmer infernal pyfaidx biopython tqdm ypytorch-cuda pytorch -c pytorch -c nvidia -c conda-forge -c bioconda
- IntaRNA: for interaction energy calculation
- snakemake: for pipeline management
- ete3: for tree operation
- scipy: implement L-BFGS-B for optimizing scores in tips and internal nodes, also required by ete3
- cd-hit: for sequence clustering
- mafft: for MSA construction
- FastTree: for 16S rRNA tree building
- mmseqs: for homolog search of sRNA and protein
- pyfaidx: for genome sequence processing
- hmmer: for detection of rpoB marker gene
- infernal: cmsearch for 16S rRNA sequence detection, required is using 16S rRNAs as phylogenetic marker
- pytorch: for Hfq binding score prediction
- The required input of CMDTarget include:
- Genome sequences
- Genome annotations in gff format
- Homologous sRNA sequences
- These inputs should be organized as follow:
indir: input directory, should contains the following subdirectory{indir}/fasta: Genome sequence in fasta format, named as '{genome_id}.fa'{indir}/gff: genome annotation in gff format, named as '{genome_id}.gff'{indir}/{hits}/hits.groupped- organized like '{indir}/{hits}/hits.groupped/{genome_id}/{sRNA_id}.fa', each file contains 1 sRNA sequence
- homologuous sRNA sequences share the same id
- An easy-to-use script for preparing input data was provided, see below.
- You have multiple ways to curate your genome set for comparative analysis. Here we provide a simple strategy.
- For testing, you can simply use 10 Escherichia genome sequences and annotations in
genomes.tar.gz, including E.coli (GCF_000005845.2) - Suppose you have a genome of interest (called query genome), you have to select several phylogenetically related genome for comparative analysis.
- You may start from GTDB genomes of the clade that contains these genomes. You may only keep refseq genome, or genome with completeness greater than certain cutoff. You get the assembly ids, starts with "GCF". Saving these assembly ids in a text file.
python scripts/select-GTDB-genomes.py --clade g__Escherichia --output genomes/Escherichia.txt
-
If your query genome(s) does not present in this list, please manually add it
-
Then fetch sequences and annotations of these genomes.
#First download ncbi assembly summary.
wget -P genomes https://ftp.ncbi.nlm.nih.gov/genomes/ASSEMBLY_REPORTS/assembly_summary_refseq.txt
# fetch genomes of interests
mkdir -p genomes/gff genomes/fasta
scripts/fetch-refseq-genomes.py --genome-ids genomes/Escherichia.txt --fasta-directory genomes/fasta --gff-directory genomes/gff --summary genomes/assembly_summary_refseq.txt
- Reformat CDS coordinate from gff to bed
bash run/gff2bed.sh
- Determine which genomes contain sRNA(s) for target prediction.
To do so, first put your sRNAs in a fasta file.
#cat sRNAs.fa
>GCF_000005845.2:RyhB
GCGATCAGGAAGACCCTCGCGGAGAACCTGAAAGCACGACATTGCTCACATTGCTTCCAGTATTACTTAGCCAGCCGGGTGCTGGCTTTTTTTTT
>GCF_000005845.2:Spot42
GTAGGGTACAGAGGTAAGATGTTCTATCTTTCAGACCTTTTACTTCACGTAATCGGATTTGGCTGAATATTTTAGCCGCCCCAGTCAGTAATGACTGGGGCGTTTTTTATT
>GCF_000005845.2:CyaR
GCTGAAAAACATAACCCATAAAATGCTAGCTGTACCAGGAACCACCTCCTTAGCCTGTGTAATCTCCCTTACACGGGCTTATTTTTT
Perform the homolog search, and extract hit sequences:
# perform homolog search, homolog sequence saved in genomes/sRNA-hits/hits.fa
scripts/sRNA-homolog-search.py -q sRNAs.fa -gd genomes/fasta -od genomes/sRNA-hits --threads 12 -gi genomes/Escherichia.txt
# group sRNAs by homolog
scripts/group-sRNAs-by-homolog.py -i genomes/sRNA-hits/hits.fa -od genomes/sRNA-hits/hits
# further group sRNA by genomes, make each file contain a single sequence
scripts/split-sRNA-homolog.py -id genomes/sRNA-hits/hits -od genomes/sRNA-hits/hits.groupped
- Here is an example config file in json format:
#example.json
{ "indir": "genomes",
"outdir": "output/Enterobacteriaceae",
"hits": "sRNA-hits",
"genome-set-name": "Escherichia",
"genome-ids": "genomes/Escherichia.txt",
"query-ids": ["GCF_000005845.2"],
"sRNA-ids": "sRNA-ids.txt",
"marker": "rpoB",
"weights": {"pair zscore": 0.7, "hfq zscore": 0.3},
"denoise": {"srm": 10, "nvm": 10, "rescale": 0, "reroot": 1},
"steps": ["marker detection","single species scoring","comparative denoising"]}
genome-ids:- A text file specify the genomes used in comparative analysis.
- One genome id per line
- For all genome_id with '{indir}/fasta/{genome_id}.fa', '{indir}/gff/{genome_id}.gff' present, only those specified in this file are used
query-ids:- A list specify the query genome(s). The genome should present in
genome-ids
- A list specify the query genome(s). The genome should present in
sRNA-ids:- A text file specify sRNAs to consider
- For all sRNAs with
{indir}/{hits}/hits.groupped/{genome_id}/{sRNA_id}.fapresent, only those present in this file are considered
marker:- Phylogenetic marker for comparative analysis
weights: weights of energy scores and hfq scoresdenoise: parameter for denoisingsteps: steps to run. one or more steps can be specified.- "marker detection": detect phylogenetic marker
- "single species scoring": scoring binding using single species mode
- "comparative denoising": run comparative denoising. as this step depends on "marker detection" and "single species scoring", if only specify this step, the other two steps will be called
- Once the data and config file are ready, the comparative analysis is fully automatic
- We recommand first run the "marker detection" step to make sure the marker gene present in genomes that will be used for downstream analysis
- example.marker.detection.json
{ "indir": "genomes",
"outdir": "output/Enterobacteriaceae",
"hits": "sRNA-hits",
"genome-set-name": "Escherichia",
"genome-ids": "genomes/Escherichia.txt",
"query-ids": ["GCF_000005845.2"],
"sRNA-ids": "sRNA-ids.txt",
"marker": "rpoB",
"weights": {"pair zscore": 0.7, "hfq zscore": 0.3},
"denoise": {"srm": 10, "nvm": 10, "rescale": 0, "reroot": 1},
"steps": ["marker detection"]}
snakemake --configfile example.marker.detection.json --jobs 16
- Marker genes were extracted to
{indir}/{marker}/{genome_id}.fa
- Define genomes set used for downstream analysis
- You may keep all genomes with marker genes
ls genomes/rpoB/ | grep '.fa$' | sed 's/.fa$//' > genome-ids.txt
- When you have many genomes, up to 8 genomes withs <0.95 sequence identity is generally sufficient
# combine marker sequences
scripts/combine-fasta.py -i genomes/rpoB -o genomes/Escherichia.rpoB.fa -gi genomes/Escherichia.txt
# get sequence identity to query marker, the result present in Escherichia.sim2query/scores.txt
scripts/select-genome-by-divergence.py -i genomes/Escherichia.rpoB.fa --query-ids GCF_000005845.2 --cutoff 0.95 -od Escherichia.sim2query/
- Refine your genome set by modify "genome-ids" in config file
example.comp.scoring.jsonfor interaction prediction, run single genome scoring and comparative analysis
{ "indir": "genomes",
"outdir": "output/Enterobacteriaceae",
"hits": "sRNA-hits",
"genome-set-name": "ent9", # an alias genome set used for comparative analysis
"genome-ids": "genome-ids.refined.txt",
"query-ids": ["GCF_000005845.2"], # genome for sRNA target prediction, multiple genomes can be provided
"sRNA-ids": "sRNA-ids.txt",
"marker": "rpoB",
"weights": {"pair zscore": 0.7, "hfq zscore": 0.3},
"denoise": {"srm": 10, "nvm": 10, "rescale": 0, "reroot": 1},
"steps": ["single species scoring","comparative denoising"]}
#--resources gpu=1 restrict jobs for runing Hfq score prediction
snakemake --configfile example.comp.scoring.json --jobs 16 --resources gpu=1
- Raw hfq scores:
{indir}/hfq - Raw binding energy:
{outdir}/{asm_id}/energies - Single species combined scores by genome:
{outdir}/{asm_id}/combined.wt.hfq/{sRNA_id}.txt - Single species combined scores by homolog:
{outdir}/scores-by-homolog-pair/wt.hfq--{genome-set-name}/{sRNA_id}.txt - The phylogenetic tree:
{outdir}/phylogeny/{genome-set-name}/{marker}.nwk